Busch Lab

ZMP

TTBK1 (2 of 2)

Ensembl ID:
ENSDARG00000056659
Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Human Orthologue:
TTBK1
Human Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Mouse Orthologue:
Ttbk1
Mouse Description:
tau tubulin kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2147036]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa45602 Nonsense Mutation detected in F1 DNA Not yet available
sa9312 Nonsense Mutation detected in F1 DNA Not yet available
sa36394 Nonsense Available for shipment Available now
sa6470 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45601 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23059 Nonsense Available for shipment Available now
sa36393 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45602
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 82 1219 2 14
Genomic Location (Zv9):
Chromosome 17 (position 21892292)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22042441
GRCz11 17 22062277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCTGCCCAACAACCCAAACAAGTGCTAAAGATGGAGGTTGCTGTGCTA[A/T]AGAAACTACAAGGTGAGGAGACGGAGAGGATATATGTGCTGTTTTGTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7829
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Essential Splice Site 215 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884561)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034710
GRCz11 17 22054546
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAACAATATAGACAACTACATTTTTCATACTCTGTTCTTTGTTTTTAAC[A/G]GGAAATGGGTCGTCATGATGATTTGYGGTCGTTGTTTTATATGCTGGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9312
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 222 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884537)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034686
GRCz11 17 22054522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCATACTCTGTTCTTTGTTTTTAACRGGAAATGGGTCGTCATGATGATT[T/A]GYGGTCGTTGTTTTATATGCTGGTAGAGTTTACCGTTGGACAATTACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36394
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 231 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884511)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034660
GRCz11 17 22054496
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAATGGGTCGTCATGATGATTTGTGGTCGTTGTTTTATATGCTGGTA[G/T]AGTTTACCGTTGGACAATTACCATGGCGTAAGATAAAAGATAAGGTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6470
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Essential Splice Site 245 1219 7 14
Genomic Location (Zv9):
Chromosome 17 (position 21884466)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034615
GRCz11 17 22054451
KASP Assay ID:
554-4659.1 (used for ordering genotyping assays)
KASP Sequence:
TGGTAGAGTTTACCGTTGGACAATTACCATGGCGTAAGATAAAAGATAAG[G/A]TAAGGCAAATGTATCACGCTCKCATCAACCAGTGACTATGAGCATAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45601
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Essential Splice Site 287 1219 8 14
Genomic Location (Zv9):
Chromosome 17 (position 21884169)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22034318
GRCz11 17 22054154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATGATCATGTGCTGGATTTGGATTATTTCACCAAACCTGATTATCAG[G/A]TAAAGCAATACATACATCTCTTATCTTCTTCTGATTTCACTACCTCATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19171
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 741 1219 13 14
ENSDART00000114470 Nonsense 741 1219 13 14
Genomic Location (Zv9):
Chromosome 17 (position 21866733)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22016882
GRCz11 17 22036718
KASP Assay ID:
2261-0958.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTGGGGATGGGCAGGGAACGCTTGCTGCTTTGACACCGCAGGGAGAG[C/T]GACCTGTGCCAGAAGAATCTGAACCTGGCACTCTTTCCTCTGTCATTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4013
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 741 1219 13 14
ENSDART00000114470 Nonsense 741 1219 13 14
Genomic Location (Zv9):
Chromosome 17 (position 21866733)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22016882
GRCz11 17 22036718
KASP Assay ID:
2261-0958.1 (used for ordering genotyping assays)
KASP Sequence:
CACCTGGGGATGGGCAGGGAACGCTTGCTGCTTTGACACCGCAGGGAGAG[C/T]GACCTGTGCCRGAAGAATCTGAACCTGGCACYCTTTCCTCTGTCATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23059
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 902 1219 13 14
Genomic Location (Zv9):
Chromosome 17 (position 21866250)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22016399
GRCz11 17 22036235
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATAGCTATTAAAGAAAATATTTCAATAGAAACCAAATTAGATGACGAA[C/T]AAGATGGTGTCACAACAGAGAAAGAACAGGAGCAAGAAGAGAGTCCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36393
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114470 Nonsense 923 1219 13 14
Genomic Location (Zv9):
Chromosome 17 (position 21866187)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22016336
GRCz11 17 22036172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACAGAGAAAGAACAGGAGCAAGAAGAGAGTCCATCTGTGTCCCCTGAA[C/T]AAAACAGAGATGCTGAAGTAGAGGATGAGAAGGATGTGTCTCCACCAGAG
Associated Phenotype:
Not determined