Busch Lab

ZMP

hdac9b

Ensembl ID:
ENSDARG00000056642
ZFIN ID:
ZDB-GENE-040109-7
Description:
Histone deacetylase 9-B [Source:UniProtKB/Swiss-Prot;Acc:Q6PBI4]
Human Orthologue:
HDAC9
Human Description:
histone deacetylase 9 [Source:HGNC Symbol;Acc:14065]
Mouse Orthologue:
Hdac9
Mouse Description:
histone deacetylase 9 Gene [Source:MGI Symbol;Acc:MGI:1931221]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22811 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa22811
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079155 Missense 243 643 6 13
ENSDART00000079159 Missense 212 612 4 11
ENSDART00000147161 Missense 209 267 4 6

The following transcripts of ENSDARG00000056642 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21963948)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20070391
GRCz11 16 19876210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACATTGAATGGGATCCCTCAGAAAATCACGCAGAGCTCTAAACTCTGG[T/C]ACACGTAAGTTGTCTTCATGTGTACTGTTTAACTTACAGGATTAATTTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28636
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079155 Essential Splice Site 244 643 None 13
ENSDART00000079159 Essential Splice Site 213 612 None 11
ENSDART00000147161 Essential Splice Site 210 267 None 6

The following transcripts of ENSDARG00000056642 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21963942)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20070385
GRCz11 16 19876204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATGGGATCCCTCAGAAAATCACGCAGAGCTCTAAACTCTGGTACACG[T/G]AAGTTGTCTTCATGTGTACTGTTTAACTTACAGGATTAATTTAAATAGAT
Associated Phenotype:
Not determined