Busch Lab

ZMP

ctcf

Ensembl ID:
ENSDARG00000056621
ZFIN ID:
ZDB-GENE-040624-5
Description:
transcriptional repressor CTCF [Source:RefSeq peptide;Acc:NP_001001844]
Human Orthologue:
CTCF
Human Description:
CCCTC-binding factor (zinc finger protein) [Source:HGNC Symbol;Acc:13723]
Mouse Orthologue:
Ctcf
Mouse Description:
CCCTC-binding factor Gene [Source:MGI Symbol;Acc:MGI:109447]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14093 Nonsense Available for shipment Available now
sa45637 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14093
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059913 None None 419 None 7
ENSDART00000079139 Nonsense 740 798 12 12
ENSDART00000124429 Nonsense 740 798 11 11
Genomic Location (Zv9):
Chromosome 18 (position 22072193)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22302416
GRCz11 18 22291482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACAGCTGCTGCCATTATCCAGGTGGAGGATGAAAGCACAGGGGCCATT[G/T]AGAACATCATTGTGAAGAAGGAGCCAGAGGGCACTGACGCAGTTGTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45637
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059913 None None 419 None 7
ENSDART00000079139 Nonsense 790 798 12 12
ENSDART00000124429 Nonsense 790 798 11 11
Genomic Location (Zv9):
Chromosome 18 (position 22072343)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22302566
GRCz11 18 22291632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTGCAGTTAACAGTCCCAGAAGCTGCACCTAACGGTGATCTTACTCCT[G/T]AAATGATCCTTAGCATGATGGACCGGTGATCTGGGGATACGTGTACACAC
Associated Phenotype:
Not determined