Busch Lab

ZMP

si:rp71-1p14.10

Ensembl ID:
ENSDARG00000056619
ZFIN ID:
ZDB-GENE-030131-8077
Description:
Rho GTPase-activating protein 42 [Source:UniProtKB/Swiss-Prot;Acc:Q6ZM89]
Human Orthologue:
ARHGAP42
Human Description:
Rho GTPase activating protein 42 [Source:HGNC Symbol;Acc:26545]
Mouse Orthologue:
Arhgap42
Mouse Description:
Rho GTPase activating protein 42 Gene [Source:MGI Symbol;Acc:MGI:1918794]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa23928 Essential Splice Site Available for shipment Available now
sa8901 Nonsense Mutation detected in F1 DNA Not yet available
sa8645 Nonsense Mutation detected in F1 DNA Not yet available
sa29585 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa29586 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23928
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Essential Splice Site 128 805 4 21
Genomic Location (Zv9):
Chromosome 21 (position 21877494)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22725907
GRCz11 21 22762512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCACACCGCTGGAGAAGTTTCGCAAAGAGCAGATCGGAGCGGCCAAAG[T/C]AAGTTCTTAGAGGCCCATTGTGAGTTAATGTTGTACGTGTCAGCGGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8901
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Nonsense 166 805 6 21
Genomic Location (Zv9):
Chromosome 21 (position 21884511)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22732924
GRCz11 21 22769529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACACYCAGAGTATAACACTGTTTTTGAATGATTTTGTAGGCAGACACA[C/T]AGATCAGKAAGGAGAGACAGGTCTTCTATGAYGCCTCTCTCGAATAWGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8645
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Nonsense 181 805 6 21
Genomic Location (Zv9):
Chromosome 21 (position 21884558)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22732971
GRCz11 21 22769576
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAYAGATCAGKAAGGAGAGACAGGTCTTCTATGAYGCCTCTCTCGAATA[T/A]GTTTTCAAAATCCAAGAAGTACAAGAGAGGAAAAAGTTTGAGTTTGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29585
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Essential Splice Site 199 805 6 21
Genomic Location (Zv9):
Chromosome 21 (position 21884613)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22733026
GRCz11 21 22769631
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAATCCAAGAAGTACAAGAGAGGAAAAAGTTTGAGTTTGTTGAGCCG[G/A]TAAGATGCGCTTATTTATGATGAAATCAGATATACAATGAAAGCTTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29586
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Essential Splice Site 277 805 8 21
Genomic Location (Zv9):
Chromosome 21 (position 21887328)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22735741
GRCz11 21 22772346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTCCGGGACAGTGGACGATGGAGGGCTTTCTCTATGTACAGGAGAAAC[G/A]TGAGTGACTTCCTGTGTCAGAGCATCTATAAATAGTCTGTGTGTTTATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3135
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Essential Splice Site 433 805 14 21
Genomic Location (Zv9):
Chromosome 21 (position 21894690)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22743103
GRCz11 21 22779708
KASP Assay ID:
554-3437.1 (used for ordering genotyping assays)
KASP Sequence:
GATAGGTGGAGTAAACTCTAAAGTCCAGCGGCTGATGACCTCAGTCTTTG[G/T]TAAAGTATCCTTCTTTTTTATGTAAAAGACATTTTTACATTGTTAGTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29587
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Essential Splice Site 434 805 14 21
Genomic Location (Zv9):
Chromosome 21 (position 21894691)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22743104
GRCz11 21 22779709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGGTGGAGTAAACTCTAAAGTCCAGCGGCTGATGACCTCAGTCTTTGG[T/C]AAAGTATCCTTCTTTTTTATGTAAAAGACATTTTTACATTGTTAGTAAAC
Associated Phenotype:
Not determined