Busch Lab

ZMP

si:dkey-24c2.6

Ensembl ID:
ENSDARG00000056551
ZFIN ID:
ZDB-GENE-070912-473
Description:
Novel protein similar to vertebrate solute carrier family 22 (Organic anion transporter) [Source:Uni
Human Orthologues:
SLC22A13, SLC22A14
Human Descriptions:
solute carrier family 22 (organic anion transporter), member 13 [Source:HGNC Symbol;Acc:8494]
solute carrier family 22, member 14 [Source:HGNC Symbol;Acc:8495]
Mouse Orthologues:
Slc22a13, Slc22a14
Mouse Descriptions:
solute carrier family 22 (organic cation transporter), member 13 Gene [Source:MGI Symbol;Acc:MGI:214
solute carrier family 22 (organic cation transporter), member 14 Gene [Source:MGI Symbol;Acc:MGI:268

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10211 Nonsense Available for shipment Available now
sa32922 Nonsense Mutation detected in F1 DNA Not yet available
sa8783 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10211
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099591 Nonsense 118 516 1 9
Genomic Location (Zv9):
Chromosome 2 (position 24132599)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24075896
GRCz11 2 23731547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCAAACCACCACTTGTACTGATGGATGGGTGCATAATGATACTATTTA[T/A]RAGGCAACCAYTGTCACTGATGTAAGTACAGTCCTAACAATGCTGCGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32922
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099591 Nonsense 454 516 9 9
Genomic Location (Zv9):
Chromosome 2 (position 24124079)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24084416
GRCz11 2 23740067
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTACTGTATTAATCCTCTTGCTGGTTTCCAGTCAGACAGCCACAGGTT[T/A]GGGCTCCACCGCTGCACGAGCCGGGAGTATGCTGTCTCCTGTGGTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8783
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099591 Nonsense 460 516 9 9
Genomic Location (Zv9):
Chromosome 2 (position 24124062)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24084433
GRCz11 2 23740084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTGCTGGTTTCCAGTCAGACAGCCACAGGTTTGGGCTCCACCGCTGCA[C/T]GAGCCGGGAGTATGCTGTCTCCTGTGGTGAACATGTTGGAAATTTTCCAC
Associated Phenotype:
Not determined