Busch Lab

ZMP

nr0b1

Ensembl ID:
ENSDARG00000056541
ZFIN ID:
ZDB-GENE-070130-1
Description:
nuclear receptor subfamily 0 group B member 1 [Source:RefSeq peptide;Acc:NP_001076416]
Human Orthologue:
NR0B1
Human Description:
nuclear receptor subfamily 0, group B, member 1 [Source:HGNC Symbol;Acc:7960]
Mouse Orthologue:
Nr0b1
Mouse Description:
nuclear receptor subfamily 0, group B, member 1 Gene [Source:MGI Symbol;Acc:MGI:1352460]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30950 Nonsense Mutation detected in F1 DNA Not yet available
sa41861 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa585
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079060 Nonsense 136 264 1 2
ENSDART00000128468 Nonsense 164 292 1 2
Genomic Location (Zv9):
Chromosome 11 (position 30562176)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29438162
GRCz11 11 29685336
KASP Assay ID:
554-0495.1 (used for ordering genotyping assays)
KASP Sequence:
CTTCGGAGACGCAGGAGCCCAGCATGCTGCAGCGGATTTTAACGAGCGGA[C/T]AGGACAAGCAGGACAACCAGAGCCATAACGGCGGAGTGGCGTTGACCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30950
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079060 Nonsense 263 264 2 2
ENSDART00000128468 Nonsense 291 292 2 2
ENSDART00000079060 Nonsense 263 264 2 2
ENSDART00000128468 Nonsense 291 292 2 2
Genomic Location (Zv9):
Chromosome 11 (position 30560307)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29436293
GRCz11 11 29683467
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTCATTGGCGCGGTCAACATGGAGGAACTTCTTCTGGAGATGTTTTAT[G/T]GAAAATAAACTTTGAAAAAAACTGGGAGAGAATTATCAGACTTGGAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41861
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079060 Nonsense 263 264 2 2
ENSDART00000128468 Nonsense 291 292 2 2
ENSDART00000079060 Nonsense 263 264 2 2
ENSDART00000128468 Nonsense 291 292 2 2
Genomic Location (Zv9):
Chromosome 11 (position 30560307)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29436293
GRCz11 11 29683467
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTCATTGGCGCGGTCAACATGGAGGAACTTCTTCTGGAGATGTTTTAT[G/T]GAAAATAAACTTTGAAAAAAACTGGGAGAGAATTATCAGACTTGGAAAGA
Associated Phenotype:
Not determined