Busch Lab

ZMP

ENSDARG00000056535

Ensembl ID:
ENSDARG00000056535
Human Orthologues:
JMJD7-PLA2G4B, PLA2G4B, PLA2G4D, PLA2G4E, PLA2G4F
Human Descriptions:
JMJD7-PLA2G4B readthrough [Source:HGNC Symbol;Acc:34449]
phospholipase A2, group IVB (cytosolic) [Source:HGNC Symbol;Acc:9036]
phospholipase A2, group IVD (cytosolic) [Source:HGNC Symbol;Acc:30038]
phospholipase A2, group IVE [Source:HGNC Symbol;Acc:24791]
phospholipase A2, group IVF [Source:HGNC Symbol;Acc:27396]
Mouse Orthologues:
Pla2g4b, Pla2g4d, Pla2g4e, Pla2g4f
Mouse Descriptions:
phospholipase A2, group IVB (cytosolic) Gene [Source:MGI Symbol;Acc:MGI:2384819]
phospholipase A2, group IVD Gene [Source:MGI Symbol;Acc:MGI:1925640]
phospholipase A2, group IVE Gene [Source:MGI Symbol;Acc:MGI:1919144]
phospholipase A2, group IVF Gene [Source:MGI Symbol;Acc:MGI:2685493]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23053 Essential Splice Site Available for shipment Available now
sa6469 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23053
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Essential Splice Site 165 837 7 20
Genomic Location (Zv9):
Chromosome 17 (position 21285193)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21435342
GRCz11 17 21455178
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGTGAGCTGAACGTGGAGATAGACAAGCTTCTTAAGAACTCTGAAGG[T/A]AAATATGTTTTCATTACAAAACATTTTCATCCTAGTTTTTCAAGTAAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4709
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Essential Splice Site 674 837 19 20
ENSDART00000079030 Essential Splice Site 674 837 19 20
Genomic Location (Zv9):
Chromosome 17 (position 21295059)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21445208
GRCz11 17 21465044
KASP Assay ID:
2261-0932.1 (used for ordering genotyping assays)
KASP Sequence:
CTTTAGGTTTGCTTGAAAACAAACATTTTCATGCTTKCTTGTGCCCAATA[G/T]GTYGTAAAGCAAGCCCAGGAATACTGCACCGATCGAAAGATCCCATTTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19170
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Essential Splice Site 674 837 19 20
ENSDART00000079030 Essential Splice Site 674 837 19 20
Genomic Location (Zv9):
Chromosome 17 (position 21295059)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21445208
GRCz11 17 21465044
KASP Assay ID:
2261-0932.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTAGGTTTGCTTGAAAACAAACATTTTCATGCTTTCTTGTGCCCAATA[G/T]GTCGTAAAGCAAGCCCAGGAATACTGCACCGATCGAAAGATCCCATTTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28840
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Nonsense 682 837 19 20
Genomic Location (Zv9):
Chromosome 17 (position 21295086)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21445235
GRCz11 17 21465071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATGCTTTCTTGTGCCCAATAGGTCGTAAAGCAAGCCCAGGAATACTG[C/A]ACCGATCGAAAGATCCCATTTCCAAAAATTGATTTCAAAAAGCTGGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6469
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079030 Nonsense 833 837 20 20
Genomic Location (Zv9):
Chromosome 17 (position 21296852)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21447001
GRCz11 17 21466837
KASP Assay ID:
554-5397.1 (used for ordering genotyping assays)
KASP Sequence:
AAGGAAAGACCTGTTCAGCACCAACACCACAACCAGGATCACAGAAAACA[C/T]AAAAGACRCAAAAGTAATCTGAATGCAAAACTTGATTMATCTTRAATTGT
Associated Phenotype:
Not determined