Busch Lab

ZMP

cpvl

Ensembl ID:
ENSDARG00000056480
ZFIN ID:
ZDB-GENE-031219-2
Description:
probable serine carboxypeptidase CPVL [Source:RefSeq peptide;Acc:NP_954972]
Human Orthologue:
CPVL
Human Description:
carboxypeptidase, vitellogenic-like [Source:HGNC Symbol;Acc:14399]
Mouse Orthologue:
Cpvl
Mouse Description:
carboxypeptidase, vitellogenic-like Gene [Source:MGI Symbol;Acc:MGI:1918537]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa5890 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa888
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078984 Essential Splice Site 325 478 10 13

The following transcripts of ENSDARG00000056480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22602409)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20706645
GRCz11 16 20512464
KASP Assay ID:
554-0795.1 (used for ordering genotyping assays)
KASP Sequence:
CCAGAACGTCACTGGTTGCACCAACTACTTCAACTACATGCAGTGTCAGG[T/C]AATGTGTTGATTCTACAGACRCATTTACTAACAATCAAACGGGTTGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5890
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078984 Nonsense 438 478 12 13

The following transcripts of ENSDARG00000056480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22603160)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20707396
GRCz11 16 20513215
KASP Assay ID:
554-3790.1 (used for ordering genotyping assays)
KASP Sequence:
TCCCCTGGAAGGTTCAGCCCAGCGACACTGAAGTCGCAGGATACGTTCGA[C/T]AAGTCAGAGARTTCTTTCAGGTGAGGGTTTGTATTGCTARATGTTTGTGT
Associated Phenotype:
Not determined