Busch Lab

ZMP

si:ch211-168b3.1

Ensembl ID:
ENSDARG00000056478
ZFIN ID:
ZDB-GENE-081104-34
Description:
Novel protein similar to vertebrate centaurin, beta 2 (CENTB2) [Source:UniProtKB/TrEMBL;Acc:B8JLA1]
Human Orthologue:
ACAP2
Human Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 [Source:HGNC Symbol;Acc:16469]
Mouse Orthologue:
Acap2
Mouse Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 Gene [Source:MGI Symbol;Acc:MGI:1925868]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2032 Essential Splice Site Available for shipment Available now
sa39760 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2032
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092525 Essential Splice Site 37 735 2 22
ENSDART00000131688 None None 129 None 4
ENSDART00000147831 Essential Splice Site 37 499 2 17
Genomic Location (Zv9):
Chromosome 2 (position 5533190)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5978918
GRCz11 2 5890800
KASP Assay ID:
554-2588.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGGATGTGGAGGAAGACTTTGGAGAACTGGAGTCAAAACTTGACAAGG[T/A]ATGATTTTCTCATTGACATACTGGCTTTAAAGTTTGCTTATGTGNNTTTT
Long Flanking Sequence:
TAAATTGGATAATGCAGGACCGGCTGTAAGCAATCAAAAGCACGTGATCCTCTTGAAATTAGTTTATAAATAAACTTCTCTTATTGCTTCACTCAGTGAACTGCTAATAATGGAAATTCTGTGATAATTGCTTTTTCTTTGTATATGTCTACATGTTACATATAAAAACATTATTAAAGTAGTTTGAATGAATAATAAACAGAGCCTTCTGTTTGAATTTAAAGAATGAAGCGATTAAATGGCGAAACAAGAGTAAACTGTGTTCAAGTTATATTCAGATGACGGGATTTGATTTCATCGGTTCCAAAGGAATTTAATCTTTGGTTCCATTTGCCTACAATTAAGTTGAAATAGCATCCTTCAATTATGTGTCAAATGTCTGTCTGTATTCATAAGTTCACAGATGATGCTTCAGATAATTTGTGCAATGATATTTTGTAGGGCCACAATAGAGGATGTGGAGGAAGACTTTGGAGAACTGGAGTCAAAACTTGACAAGG[T/A]ATGATTTTCTCATTGACATACTGGCTTTAAAGTTTGCTTATGTGTTTTTTTTTTACTTTATATATTAGAATTGTTTGCCATAATAGAATAATGGAGGTCACACTTAAAGAAAAAACACAACAGTTTTATTCTTGGGTCTGAACAACAAACAACTAGCACCAACGAAACTCAACTGTGTTGCACCCTCAAGTTGGATTGCATCTAGACCCAAAATCTGTGCGTGAACACACCGAATGGACGAAAGGCGGCTGGAACAAGAGCCACGTTCTAAACGTCTGCAAGATTACGTGTCTTTCCACGGGGGAGCGTATCTGTTTACTTCCAAACTTCTTCCAAACAAAGCAGCATTCAGTACCGTTATCACAGTAATTGTCACTCACCATGGAGGGATTTTCTCATGCAAATAAGTCTGATAATCCAATAATCCATATGGTTTGCAAATATTTGAGAAATATAGCAAAATTATCGTGTTTTGATTTGTTGCAGAATAACCAGTCAGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25754
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092525 Essential Splice Site 95 735 4 22
ENSDART00000131688 None None 129 None 4
ENSDART00000147831 Essential Splice Site 95 499 4 17
Genomic Location (Zv9):
Chromosome 2 (position 5539155)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5984883
GRCz11 2 5896765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAGCAGCATTTTCTGAGACTCTGCAGGAGATGAACAACTATCATACAG[T/C]AAGACATCAGAAAGTATTAGATATTTGTATGTGTATTTTGTGACAAAACC
Long Flanking Sequence:
TCTGTCTAAGTAACAACAGAAGGGTCAAACTTTAAATAGGAAAATTACCGAAAACTCTTTGGTCATTTTTAAATAATGCAGATGCTAATGGTCTACTCCGATTCAGTGATCTATGCTAAGCTATGCTAACCCTAATCTTTAAAATCTGATGTGTTGTCTCATGTTTGAAATCACAATATATTGACTGATTATGTTTTTTTTTCAGCTGGTGAAGTTGTGTATTGGGATGATAGACGCCGGAAGAGTTTATAATCAGGCCAACAAGCAATTTGTGAATGGAATCCGAGATCTAGCTTTACAGTCAACCAGAGACGAAGTCATCGGGGTAAGAGAGACAGCGCTTTTTGCTTTCTGTTTCTCGAAAGCTTTCAGTATTTCTGCTTCTGTGTTTGTCTGATTTTGTGCTGCTTAATAATTCTTTTTTTTCCCCTCTCTCGCTATTTAGTCCAGTTTAGCAGCATTTTCTGAGACTCTGCAGGAGATGAACAACTATCATACAG[T/C]AAGACATCAGAAAGTATTAGATATTTGTATGTGTATTTTGTGACAAAACCTCCTGTTTAAAATATCTGTTCATGGCATGCGGTTAGATAATCTTGGGAGTCAAAATTGATCACATCTGACATAGACAGTTTAAGTCAGAATTATTAGCCCTCCTGAATTATTCCCATTCTGAAAACATAGCCCTATATACGTTTCTGGGGATTGAGAATTATGTAGCCAGAGGCTTGTATGGCTGCATTTCATCTTTAAAATGAACGCTACGGGGCGGTATGATGCAGTTTCTTTTCACGCTTACCAGATGAACGCTTACCACCATATGGATGGCTTTCCCGCTGTTACTAGTTTGTACAGTAGCTATCCATGTACATTAACGGACTTGAGACGCAGAGTTGACCACAATGACAGGGTTTGAGTCTGGTTCCAGAAAGGACGGTTTTAGTAAGACAAAAACAGAATCCTAAATATTAAATAAATAAGTAAATAACAGGGTGAGAATGTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25755
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092525 Nonsense 342 735 13 22
ENSDART00000131688 None None 129 None 4
ENSDART00000147831 Nonsense 346 499 14 17
Genomic Location (Zv9):
Chromosome 2 (position 5551938)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5997666
GRCz11 2 5909548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCATTTGACTCACAGTAGCTGCTGTTGTGCGTCAGGAGCTGTATGATG[C/T]AGGCGGACTCGGAGAAGCTGAGACAGGCCTGGATCAAAGCTGTGCAGAGC
Long Flanking Sequence:
TCGTTCTGGAAATTTTCCAGATATTTACCGGTATCACTGTGTGAAAGGGGCTATTGACAATAATTTATTTTATATAGCGCAATCACACAATAACACAAAAAAGGATCATTATTGAAACTTTTATTTTGAATGAGATGCTAATGGTCTAATCTAAATAAATGATTTATGCTAAGCTAAGCTAAAAATGCTCCCAGAGATTGACTGAATGGATTAAAAAATACTCAAAGTTGTAAAATGATTTATTTAAAAAAAATGTAAATTGTGTAGTGTTTCTTTAAAGTGTTTTTATAGGTTTGAAATGTTTCAGGATAACCCCACTGTGGTGGTAGAAGATCTGAGACTCTGCACTGTTAAGCACTGTGAGGACGTGGAGAGACGCTTCTGTTTCGAAGTGCTGTCTCCGTCAAAGTATGTTTCGGTCTGTCTTTTCTTATTACACATCGTTGTGTTGAGCATTTGACTCACAGTAGCTGCTGTTGTGCGTCAGGAGCTGTATGATG[C/T]AGGCGGACTCGGAGAAGCTGAGACAGGCCTGGATCAAAGCTGTGCAGAGCAGCATTGCCTCGGCCTACAGAGAGAACGAAGACGAAATTATTGTGAGTATTTCTTTTTCTTTTTCAAATATTTCCCAAGTAATGTTTACAGGGCAAGGAATTTTTCACAGTACTCAACAAATCATCTGTTGAGCTGCATACCAATCATCACAAATACTGCAGAAGACCTACTGGAACCCGCATGGGCCCTAGATTCTTACCGAAGTCAGTCAAGTTTGGTGAAGGAAAAATCATGGTTTGCGGTTACATTCAGTATGAGGGCGTGCGAGAGATCTGCAGAGTGGATGGCTACATCAACAGCTTGACAGTGTGCTAATGTTCGTGAATTTGTTTTGCTTGCTGTAGAGTCTCGACAGGCAGTCGTCAGCCTCTCTGGGCAGTCTGGACTCCGGCTGTGAGTCTGTGAAGCTGGTTAAAGGTGAGAGTGCTCTTCAGCGGGTGCTGGCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39760
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092525 Essential Splice Site 436 735 15 22
ENSDART00000131688 None None 129 None 4
ENSDART00000147831 Splice Site None 499 None 17
Genomic Location (Zv9):
Chromosome 2 (position 5553070)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5998798
GRCz11 2 5910680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTGGCATAATGAAATTGACATAAATATTGATAATTATTTTTTTTCTTT[T/C]CAGGAGTTTAGGAGTTCACAATTCAAAGGTGCGATCTCTCACACTCGACA
Long Flanking Sequence:
ACCTCAAGGGTAGTTCATGTGTTGGTGCTCTTTGAATAAGGGATTCGTAAAGATAGATGACAAAATCAACGACCTTTATTGTTTTAACACCTCTAGTTTGGAAAAAGTCAGGAAAGTGTCCAGCTCTGTTTAGGTGGCAAGGTGCATAAAAAATTTGCACAAAAATGGGAGTTTTCGGTTCGTGCACACAGAGGCAATACAAACACACAGATGCAGAGGAGATGTCAAAAACCAGGGGTGTCCAAACTCGGTCCTGGAGGGCCGGTGTCCTGCATAGTTTAGCTCTAACTTTGTTTAACACATCTGCCTGGAGCTTTCTAGTATGCCTAGAAAGAGCTTGATTAGCTGGTTCAGGAGTGTTTAATTGTGGTTGGAACTAAAATATGCAGGACAGCAGCCCTCCAGGACCAAGTTTGGGCAGCCCTTGTGTAAACCAATTAGAGGACCCAGAATTGGCATAATGAAATTGACATAAATATTGATAATTATTTTTTTTCTTT[T/C]CAGGAGTTTAGGAGTTCACAATTCAAAGGTGCGATCTCTCACACTCGACACATGGGAGCCAGAACTGCTGAAGGTAAAAGTGCATTGTTAGGGGGTTTAATTTGTGTGTTTTGGTGTTGTGGTGTATTAATTCACTCATATGTGCCGTATGTTTAGCAGTTGTCTCACTGTGTGTTTTATTTGCAGTTGATGTGTGAGCTGGGAAATGATGTTATTAATCAGATCTATGAAGCGCACAGAGAAGAGAATGGTGGCAAGAAGCCTCAGCCTGGAGATCCCAGGTATCCTGAACACTGTTTGTCTACACTACCTGACCAAAGTCTTATCGCTAATCCCAGTTGTAAGAGCAACAAATAATAACTTCACTTCTAGTTGATCATTTGGAAAATTGGCAGAAGGTCGACTTCTTTAGATGAATCATCTGTTGAGCTGCATCCTAAACTTCAGAAATACTGCAGTAGACCTACCTGAACATACATGGTACATACATAGGGGCCTGT
Associated Phenotype:
Not determined