Busch Lab

ZMP

si:busm1-163l24.3

Ensembl ID:
ENSDARG00000056469
ZFIN ID:
ZDB-GENE-030616-179
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q8AW63]
Human Orthologue:
DTX3L
Human Description:
deltex 3-like (Drosophila) [Source:HGNC Symbol;Acc:30323]
Mouse Orthologue:
Dtx3l
Mouse Description:
deltex 3-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2656973]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33144 Nonsense Mutation detected in F1 DNA Not yet available
sa19985 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33144
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078977 Nonsense 422 1124 3 5
Genomic Location (Zv9):
Chromosome 3 (position 19878728)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19841763
GRCz11 3 19991503
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCATCCCCTGAACCCTTGGAGAGAGAGCAACAGGTTATGGGTGCCCCT[C/T]AAACATTAGTTCCCCCCAAACTAATTGGTTCCAGCACTGAACGAAAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19985
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078977 Nonsense 540 1124 3 5
Genomic Location (Zv9):
Chromosome 3 (position 19878374)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19841409
GRCz11 3 19991149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACCCGCTATCTCTGAATACATTTGGTGGAACCACCTTCAGCACATCC[A/T]AGGCCAAACCAAGTACTTCCGCTGGACTCACTTCAACACTGGGAACAGGA
Associated Phenotype:
Not determined