Busch Lab

ZMP

zgc:153096

Ensembl ID:
ENSDARG00000056453
ZFIN ID:
ZDB-GENE-061013-428
Description:
actin filament associated protein 1-like [Source:RefSeq peptide;Acc:NP_001070755]
Human Orthologue:
AFAP1L1
Human Description:
actin filament associated protein 1-like 1 [Source:HGNC Symbol;Acc:26714]
Mouse Orthologue:
Afap1l1
Mouse Description:
actin filament associated protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2147199]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44971 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29624
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078949 Nonsense 85 754 4 19
ENSDART00000078953 Nonsense 85 210 4 8
ENSDART00000122122 Nonsense 86 756 4 21
Genomic Location (Zv9):
Chromosome 21 (position 29185518)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30404762
GRCz11 21 30441457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAATTTTGATACTTGTTCTCAGACTGTGACCTGCAGGATCTCAGGGACT[C/A]GCCTGAAGAAATGAAAGATGTGGAGCAAGAGGAGGCATCTAAGCACATGC
Long Flanking Sequence:
AGAAAACACTGAACAGCTGAGCAGAAGCGCTTTGCATGAGATTCACACATTAATCACTGTAGCAATGTCCAAATATTTCAGAATTAACATAAAAAATCTTGAAGATGAGAAAACTTGCTGCTATCTTCCGTGTAGTGTGTAAAATGTTTTAAGTGTGTGTGCTGTGGATGTGTTTATTCTTCCGCAGTGAATGGATCTGACTTCATATACATGAACACGTCTCTATATGGAAATGGTACCAGCTTTGTTGAATCACTGTTTGAAGAATTTGGTGAGTTAACAATTATAAAGCTTTCACTTTTAGCAGAAATTCAACTTTTCTTTTGAACAAATAATCCTGTTTTTAGTACATAAGAAACAACTCAGCTAAATACTGTCTACAACATTAAAGATAATTGATGCATTGTTAGATAAAATTATACTCCCTGGAAGTCATATGAATTGCATGCTATAATTTTGATACTTGTTCTCAGACTGTGACCTGCAGGATCTCAGGGACT[C/A]GCCTGAAGAAATGAAAGATGTGGAGCAAGAGGAGGCATCTAAGCACATGCCTATAAAATCGGTAACATCGGTGACAACACAAACACATAATTATTATTTCAATGCTTGGGGGATAAGGTTTGTTTTACAAAATTAATATGCTTATAAAGCAAACATGCACTGAATTGATCAAAAGTGACATTTTATAATGTTACAAATGATATTAAGCAGCACAACTGTTTTCAACATAGAGGATAGTAAAAATATACGTTTATTTAAACATGAAATCATTATGTTACACTGATTTCTAATGTGACACTGAAGACTGGAACACTAAAACAGAAAATTCAGCTTTTAATGACAGGAATAGTTGTATCCCACATGGAAAGAACCTACATAAACATATATGTTTTAATATAGGTTTTGATATAGCTTTTTAAAATATGTGACATATCAAATTGGCCATTTTCCTATATTATATGTACATATATGCACATATATGTGTACAGACAGTATGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44971
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078949 Essential Splice Site 307 754 8 19
ENSDART00000078953 None None 210 None 8
ENSDART00000122122 Essential Splice Site 308 756 8 21
Genomic Location (Zv9):
Chromosome 21 (position 29180283)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30399527
GRCz11 21 30436222
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTAGTACTGGCTGTACAGAGCAAAGAACAGGCCGAGAGCTGGCTAAAG[G/A]TGCTGCACCACAGCATATAATGTACTATCACAGCACGCAATGTACTATCA
Long Flanking Sequence:
TCTGTTGATGTCAACAGACAATGATTCAGATGCTCTCAGCAGTTCTTATGAGTCATATGATGAAGAGGATGAGGAAGCCAAAGGCAGAGAGCGGACTCATCAGTGGCCATCAGAAGAAAGTCCGCTAGGCCAAATGAAAGACTGCCGCAAATGTGCCTTCCTGCTGCGCAAGAAACGATTCGGTCAGTGGGCGAAACAGCTCACAATCATTCGTGAAAACAAACTTCAGGTGAATATAAACACTGGGACTGTTTTATCCATAACCAATGAAGGAAGGTGTTTTAAATTCAGACTTTGATCATGGCATTTATTCTCTGCAGTGCTTTAAGAATCCTAAAGATCGCTCTCCTCATGTTGACCTCCCGCTAAATCTTTGCAACGTCATCTATGTGCCCAAAGATGGACGACGCAAGAAGCACGAACTCCGCTTCTCCCTGCCGGGAGGAGAGGCTCTAGTACTGGCTGTACAGAGCAAAGAACAGGCCGAGAGCTGGCTAAAG[G/A]TGCTGCACCACAGCATATAATGTACTATCACAGCACGCAATGTACTATCATTTCTGTTTACCAAATAAACATATAAATTAGCTTGAAATTTTGTTTATTGATAGACAACATGAATATTTCTTTGTTTTAGTCATGCTTTATCATAAAGTTTCAGTTTGAATTTGTTTTGTAATTTACTTAAGTTTTATACTTTTTTATTTATTTAGGTTGCTAATGCATTCATTCCAATTTTCATTTGAGTTTTCAGGTTAGTTTTCATGCTCAATATTTACTCTGTTTACTCCAGATTTATTATTTCAGTTAGCAAAAATGATTTTGAATAGTTTGATACTTCATTTTTGGCTTTCAAAACAAAAATTTGGCTATAATGTTTTATTATTTGTCTGTAATATCCTTGAAATTATGTATAAACTACTAAATTTGAGAGGGGTCTGGGTGCAGACCTGGCACAGTGCAATCTGAGCTGCATCCAAATCTTTTTTTAATACGCTCACCTAACC
Associated Phenotype:
Not determined