Busch Lab

ZMP

si:ch211-30b16.2

Ensembl ID:
ENSDARG00000056450
ZFIN ID:
ZDB-GENE-060503-511
Description:
Glycoprotein endo-alpha-1,2-mannosidase-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q1L8D2]
Human Orthologue:
MANEAL
Human Description:
mannosidase, endo-alpha-like [Source:HGNC Symbol;Acc:26452]
Mouse Orthologue:
Maneal
Mouse Description:
mannosidase, endo-alpha-like Gene [Source:MGI Symbol;Acc:MGI:2684896]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa10135 Nonsense Available for shipment Available now
sa23487 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10135
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078951 Nonsense 51 442 1 4
Genomic Location (Zv9):
Chromosome 19 (position 16692719)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17356323
GRCz11 19 17260685
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTCTCAGATCTTGCACCAGGAATGGAGCTGATGCCTTTGGTTRGAGAG[C/T]GAATGGAACAGAGACCCAATCATTTAATAGAATCAGCAGGTCAAAATGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29179
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078951 Nonsense 201 442 2 4
Genomic Location (Zv9):
Chromosome 19 (position 16693285)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17356889
GRCz11 19 17261251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGCAAACCCTCAGAGGATCTAGTGCCTGCTGTAATGGATGCTGCCCAT[A/T]AACACAGTATCAAGGTAACTGGTGAGAGAACTTATCTCCTCTTACAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23487
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078951 Nonsense 255 442 4 4
Genomic Location (Zv9):
Chromosome 19 (position 16706671)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17370275
GRCz11 19 17274637
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGGTTTAAGTCCAGCACTGGGAAGATCCTTCCACTCTTTTATGTATA[C/A]GACTCATACCTTACCCCACCTGAGACCTGGGCTGAGCTGCTAACCATCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4798
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078951 Nonsense 369 442 4 4
Genomic Location (Zv9):
Chromosome 19 (position 16707013)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17370617
GRCz11 19 17274979
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGCCATGGAACAACCATAATACACGCAAMAGAGTGAATGGACGATATTA[T/G]GAGACCTCTTTGCAGGCGGCAATGWCAGTAAGGCCTGATATCATCACAAT
Associated Phenotype:
Not determined