Busch Lab

ZMP

sf3a3

Ensembl ID:
ENSDARG00000056447
ZFIN ID:
ZDB-GENE-040908-1
Description:
splicing factor 3A subunit 3 [Source:RefSeq peptide;Acc:NP_001004289]
Human Orthologue:
SF3A3
Human Description:
splicing factor 3a, subunit 3, 60kDa [Source:HGNC Symbol;Acc:10767]
Mouse Orthologue:
Sf3a3
Mouse Description:
splicing factor 3a, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1922312]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12602 Nonsense Available for shipment Available now
sa39239 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43249 Nonsense Mutation detected in F1 DNA Not yet available
sa18610 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12602
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078924 Nonsense 138 501 7 19
ENSDART00000141102 Nonsense 56 419 3 14
Genomic Location (Zv9):
Chromosome 19 (position 16735089)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17398693
GRCz11 19 17303055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTATGTGATTATAGACTTKGTGGAGTTCACTGATGAAGAGGGTTATGGG[C/T]GATACCTGGATCTCCATGACTGCTACCTAAAATATATTAATCTAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39239
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078924 Essential Splice Site 156 501 7 19
ENSDART00000141102 Essential Splice Site 74 419 3 14
Genomic Location (Zv9):
Chromosome 19 (position 16735032)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17398636
GRCz11 19 17302998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATCTCCATGACTGCTACCTAAAATATATTAATCTAAAAGGAGTAGAG[G/A]TACAGCCTGACATCTTTGAATTGATTATCTCTAAAGAAGTAAACCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43249
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078924 Nonsense 206 501 9 19
ENSDART00000141102 Nonsense 124 419 5 14
Genomic Location (Zv9):
Chromosome 19 (position 16734462)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17398066
GRCz11 19 17302428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGGAGTACCTGCAGGAATACACAGATCGCGTCAAGCCTTTGCTGGAT[C/T]AGAATGAGCTGTATGGAAAGATTTTGGCAGAGTTTGAGAAGAAGTGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18610
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078924 Essential Splice Site 458 501 17 19
ENSDART00000141102 Essential Splice Site 376 419 13 14
Genomic Location (Zv9):
Chromosome 19 (position 16725593)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17389197
GRCz11 19 17293559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGACCCATCTGGATGGTTATTTATATTTAATTNNNNGTTTGTTTCTCTGCAAT[A/C]GTGTGGTCAAAACTGAAGTCACAGAAAGCATTGGAGCGATGGCAGCCTGA
Associated Phenotype:
Not determined