Busch Lab

ZMP

auts2

Ensembl ID:
ENSDARG00000056427
ZFIN ID:
ZDB-GENE-030616-571
Description:
Novel protein similar to human autism-related protein 1 (AUTS2) [Source:UniProtKB/TrEMBL;Acc:Q7ZZ40]
Human Orthologue:
AUTS2
Human Description:
autism susceptibility candidate 2 [Source:HGNC Symbol;Acc:14262]
Mouse Orthologue:
Auts2
Mouse Description:
autism susceptibility candidate 2 Gene [Source:MGI Symbol;Acc:MGI:1919847]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa21753 Nonsense Available for shipment Available now
sa45409 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21753
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078920 Nonsense 77 1019 1 15
ENSDART00000137928 None None 995 None 14
Genomic Location (Zv9):
Chromosome 10 (position 27832306)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 27235100
GRCz11 10 27196813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTCTTCATCTTCAGCCACCCCCTTCCAGCAGGGGGTTACCTTTGCCCT[C/A]GAGGCCAGCTCAAATCCAGAACCCTTGCCCAGAGCGCACACTAAGGCCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3751
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078920 Essential Splice Site 403 1019 8 15
ENSDART00000137928 Essential Splice Site 368 995 8 14
Genomic Location (Zv9):
Chromosome 10 (position 27825938)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 27228732
GRCz11 10 27190445
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTCTCTCTCACTCGTGCTCTCTCTTTTTTTTTTTTCCCTCTCCTCTCT[A/G]GCTGACAGATCCGTTCCGGCCGGTTCTCAGGGTAAGACTRCTTTATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45409
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078920 Essential Splice Site 594 1019 None 15
ENSDART00000137928 None 570 995 13 14
Genomic Location (Zv9):
Chromosome 10 (position 27821435)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 27224229
GRCz11 10 27185942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCAGTCAGCTCACATGAGAGAGAACGAGAGCGGGACAGAGAGAGAGAG[C/A]GGGACCTGGACAAGAGGGACTCATCAGTCAACAAGGATGATAAAGAACGG
Associated Phenotype:
Not determined