Busch Lab

ZMP

adipoql

Ensembl ID:
ENSDARG00000056411
ZFIN IDs:
ZDB-GENE-060825-220, ZDB-GENE-060825-220
Description:
adiponectin [Source:RefSeq peptide;Acc:NP_001038890]
Human Orthologue:
ADIPOQ
Human Description:
adiponectin, C1Q and collagen domain containing [Source:HGNC Symbol;Acc:13633]
Mouse Orthologue:
Adipoq
Mouse Description:
adiponectin, C1Q and collagen domain containing Gene [Source:MGI Symbol;Acc:MGI:106675]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14942 Nonsense Available for shipment Available now
sa19656 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14942
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058105 Nonsense 29 275 1 2
ENSDART00000078901 Nonsense 29 275 2 3
Genomic Location (Zv9):
Chromosome 2 (position 3182907)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4653526
GRCz11 2 4494151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGACTGGWCATCTGTGTGGAGGTCAAGACGAACTACTAGAGGACAGTT[T/G]AGAGACAGCAGTGGATGAAGTGGCCACTGAGGGAATCRAGGAGCTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19656
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058105 Nonsense 237 275 2 2
ENSDART00000078901 Nonsense 237 275 3 3
Genomic Location (Zv9):
Chromosome 2 (position 3179699)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4650318
GRCz11 2 4490943
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGGACCAGGCGTCAGGCTCTGTGATCTTGCGTTTGGAGGCAGGAGAT[G/T]AAGTGTGGCTGCAGGTCTATGGAGACGAGACGGTTGGAGGAGTGTATGCT
Associated Phenotype:
Not determined