Busch Lab

ZMP

irf8

Ensembl ID:
ENSDARG00000056407
ZFIN ID:
ZDB-GENE-040718-367
Description:
interferon regulatory factor 8 [Source:RefSeq peptide;Acc:NP_001002622]
Human Orthologue:
IRF8
Human Description:
interferon regulatory factor 8 [Source:HGNC Symbol;Acc:5358]
Mouse Orthologue:
Irf8
Mouse Description:
interferon regulatory factor 8 Gene [Source:MGI Symbol;Acc:MGI:96395]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4756
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078894 Essential Splice Site 195 423 5 8
Genomic Location (Zv9):
Chromosome 18 (position 30514890)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30592358
GRCz11 18 30570612
KASP Assay ID:
554-3557.1 (used for ordering genotyping assays)
KASP Sequence:
TTCACAGCTGCTGTTGTTCATCAGGATCCTGCAGGCYCATTAAATTCTGG[T/A]ATGTCATTTACATTGTATATTACATTGCATTATTATTATGTTTCAGTCAG
Long Flanking Sequence:
TGGATGAAATTATTAAAGAGGTATTGCCACTTTTAATCAGTTAAATGCCACCTTTCCCTTAGAACAAAAAAGGTATTAGGTAATGATTTTGTATTATCTGGTGATGTTTGATTGATGGCTCATTTCTGAATAATCTGTGTGTGTGTGTGCAGTCTTCAAATGATGAATACATGGGCATCTTGAGAAGTAGTCATTCTCCCCTGGATGAACGCAGTAGCATGCCTTCAGTGCAAGAATGGTGGCAGCAAGGACCTCTCAATGGTAATTAATGTCTAGTTTATTTAGGTTTTAAGTAAGTTTAAGAAGTTGGATAAGAGTAACTTAAAGTACTATCTTGATTTCTTGACTTTCTTAAGTAAATGTTTAAAAAATATAAAAATGTACAGTATGAATTGTTTTGTCACCTGACTCCCATGTGTTCATGTTAATAAGCATTTGTTTTTACGTACATTCACAGCTGCTGTTGTTCATCAGGATCCTGCAGGCTCATTAAATTCTGG[T/A]ATGTCATTTACATTGTATATTACATTGCATTATTATTATGTTTCAGTCAGAGCTGACTGAAAGAAACATGGGAAATCTGTTTTAATCTCTTAGTATTTTCACTGCTGCACGAGGCTGATCACGCATTTCTCGTTTTTCTCCAGCATTCTCTCAGATGTTGATTTCTTTCTACTACGGAGGTCAGATGGTGGACAACATGGTGACCACTCATCCAGAGGGCTGCCGTATCTCCCCCTGCCTGCCCTCTACGGCTAATGGCTTCTTGTACGGGTCAGACAGCCTCCAGAACATTTACTTCCCATCCATTGACGGCATTAAGAATGAGCGCCAGCGTCACGTCACCCGCAAACTTTTCAGTCACTTGGAGCGCGGCGTACTGCTGCGTGCCAACAGAGAGGGCATTTTTATCAAGCGTCTGTGCCAGAGCAGAGTGTTCTGGATTGGCCAGGATGCTCGGTACAACCCCTGCAAACTAGAGCGAGATGCTGTGGTGAAGATCT
Associated Phenotype:
Not determined