Busch Lab

ZMP

dusp22a

Ensembl ID:
ENSDARG00000056396
ZFIN ID:
ZDB-GENE-040718-219
Description:
Dual specificity protein phosphatase 22-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LWL2]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32212 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7861
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078888 Essential Splice Site 7 208 1 7
Genomic Location (Zv9):
Chromosome 18 (position 30455706)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30533174
GRCz11 18 30511428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTAACAGTCGTTCCTGACAAATAACCATGGGRAATGGAATGAATAAG[G/A]TAATGAGCGTTATAATACTTGCGKATAATTTWGTTTATTTCTCATTACGG
Long Flanking Sequence:
CCTGGTGTGGAAAATAAAGTGAAAATGTGGGGAAAAGTGGTAAAGTTTGGTAAATGATGGTAAATTAAATTTTGGGGGTGAACAATGAAAACTGCATAACATGTTTTAAATTCGAGATTAAACATGTAGTTGTTTTACCAGTGCTGTTTCTCAGAGAATCGAGTTGTGTGTATACTATTTTCAAAAGGACTTATCTTGTAGTGACGTTGTGGTCAAAGTTTACTCCGCGAGTAAACGTTTATTGAAGTTAAGAAAGGGTTAAAGTCTATGCTGTGACGTCAAAAAGGTTCAATGTTTTGATTTCGGCAGAATTCCGGAAGCTGTCACACCGACTGTTTTCTTCTGTGAGCTTACTGAATATAATTAGACTTTTACTATTGAACGCAGTCGTTTTCGAGCCGCATGTCGATTCTCTGATGCAATGAACATTCTGAGGTCTGTTTGCACGTAAACTTAACAGTCGTTCCTGACAAATAACCATGGGGAATGGAATGAATAAG[G/A]TAATGAGCGTTATAATACTTGCGGATAATTTTGTTTATTTCTCATTACGGTAGTGGGCCATGTTAAATGTCAGCTGCTATATTTATAAATTTGACATTTAAATAGCCTAGACGCCAGGCACAGTCTGTACACTGTATACAGTTACGTCTAATTCTTTATTCATTATTTAGCCTTTCAGTGCCCTCACTAAAAGTACACTGAGGTGGTACAACGTATGTTTTTACAAACACAAACCGATCACAGTAGGCTGTATTGCTACATCACGCTGTTACTTTGTGATATAAGGGTGATATTTAACATAACATCATGTTATATCACGATTACACTGGGTGCGCAGTTCTTTAATTTATGTGTTAATTAGGTCAGTGCAGCTTCTGTCTGCCTATGCAAATTGTTGTCAGGTTACAGGTTATTGAATTGTTCATTAAACCGGACAAGTTAAGTCAACGATAAGATTTTTTTTCTTTGTGTTATCTGAATGTCATTGTAAACGCAGCATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7862
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078888 Nonsense 50 208 4 7
Genomic Location (Zv9):
Chromosome 18 (position 30469251)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30546719
GRCz11 18 30524973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATTTTAAATATTAATTTATTTGTGCTCTCTCCGACAGGATATGACCTA[T/A]CTGTGCATTAATGCAGCTGATGCCTCCAGTCAAAACTTGTAAGTTACAGT
Long Flanking Sequence:
GAATGAGGCTTAATTACTGAGAGAATTCAGCTGCTGTCTGGGCATTTACTGCCTTTCAATACCTCCTTTTCTTCAAGTGTTCAATACTTTTCCCTGTCATTTCATTTTAATAGGCGTAACATAATTATAATTGGTAAACTAATTATATTTGTTTTCTTTGCATATATGTATTACGTTGGTTGTTACCAACATCTAGGGAAAATTTCTAGTCAACTGCACGTTTTTTTGAGAACAATTGTGGTGTTCAATACTTATTTTCCCTGCTGTATATATTCTTTTAAAATGTATAGTCTGGCAATTGAAATAAAAAGAAATAAACGCCTCCAAGTAATCATTAATACACAATCAGTCATAAAGTAATAAAAAGGAATAAGTCCTGTCATATTGTGCTCTTTTATAGTCTGTGACAAGACTTTATGACATTTATGTGCTGCACAAAAGAATAATTGTTTATTTTAAATATTAATTTATTTGTGCTCTCTCCGACAGGATATGACCTA[T/A]CTGTGCATTAATGCAGCTGATGCCTCCAGTCAAAACTTGTAAGTTACAGTACATACACTGCACAACAAGCTTTTTACACAATGCTTGGATAGAAACACTGAATCATGTTTAGAAAGACCTGTTGTACAATGTGTACAACACTAATTTGAAATGACAGCTTTTCCTCATAGTCACATGACCTTCTTATGATGAGTGTGTATGCTTGTTGGTGTGTGTACATAAATTATATCTTTAGTAAATGTTATTGTTCGAAACATCTTTTTGAAATGTATTCTCATTATAGCATTATGCTTCCTTCTTGTTTGCTTTGGATTCATAATTTTGCCTTCTTTCAAAGTTGTATGTGTGGATAAACTTGGATGGATTTATTTGTTTTTATTAATTAATTAATTAATTAATTTTATTTATGTATGTATTTATTTTTTTATTTTTGATATGACCACTGTGGTTAGTTTGTTGAGTGTTTACACTGTTTTTGATCTTGTCATTTCTCTACATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32212
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078888 Nonsense 189 208 7 7
Genomic Location (Zv9):
Chromosome 18 (position 30508400)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30585868
GRCz11 18 30564122
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCAGAACAGCAGCAACAAGGACAACAAAATGATCCGGAGTGGATGAGC[C/T]AGGGCTCTCGCATCTATCCTCTGTCCTACAACCAATACAGTGCCTCGGGC
Long Flanking Sequence:
AAAATGCTTATACACTATTCGACCACTCTTATGCTCACAGAGGAGTTCTGGTTTGGATAAAGAACATTTGCTCCATTTGTTCAGACCAAAAGTGAAACTGATTTGTGACAAATTAACTTTTAGACATTCCAGGAAACCTTTAATCGCTTCCAGTGAAGGCATTAATATGAGGCTTTTTTATTGTGCTAATATAAAGTTGTCACTGTAGTTTATTCATATCATATACTGTACCTGCATGAATATGATTGCGTTAACTGAGTCTTCTGAAACTGTAACGTCTCTGAGTATACTGCAAGTGTCAGTTTGATGACAGAGCAGGATATATATATATATAAACGCTCACTTTGCACTGCTCTCTCTGTCTCTTTCAGTATCAGGCATGGTTGCGGGCCAGCTATAGATCCAGCCCATTTAAAGACCAGGAACAGGTTGAAGCTTTACTGAGTCTGTTTGCAGAACAGCAGCAACAAGGACAACAAAATGATCCGGAGTGGATGAGC[C/T]AGGGCTCTCGCATCTATCCTCTGTCCTACAACCAATACAGTGCCTCGGGCAGCAACAGGTGAAAGCAGACTTGACCAGGTCTCCGCTGCCCACCAGATTTACACCCTGAAAGGACTAAAAGAGCATGTGTGGCAATTCCCACATGTGCAGATCATTTCAAAAGAGAGATCATAGAACACTTTAGATTACAGTCATGCTGATGTGAGCATTATGAAAACGGTAATAGCGAGTTCATTAACCATTGATCACTCAAAGAGTATTTTTTCCTTTATAAGTTGTTGGAATCTGATAGAGTTAGTCGCCAGCATTGCTGTATTTTTAAAAAAACGCATCCCCCACTGCTCTACCTCCAAAATGATAAGGATGCCTTTAGATCTTTTAGTTGTCCGACATTAGATTGATAATAGATCAGTGCTAAAATGCTCTAAGCGCATAAATTGCTTTATAAAATGCAGTATTTGGACCGCTAATGTGTAATTTATGCTTTGTATTTCATATAC
Associated Phenotype:
Not determined