Busch Lab

ZMP

si:dkey-229d2.1

Ensembl ID:
ENSDARG00000056386
ZFIN ID:
ZDB-GENE-060526-261
Description:
Novel protein similar to vertebrate transmembrane channel family [Source:UniProtKB/TrEMBL;Acc:A2BFV3
Human Orthologue:
TMC1
Human Description:
transmembrane channel-like 1 [Source:HGNC Symbol;Acc:16513]
Mouse Orthologue:
Tmc1
Mouse Description:
transmembrane channel-like gene family 1 Gene [Source:MGI Symbol;Acc:MGI:2151016]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa40426 Nonsense Mutation detected in F1 DNA Not yet available
sa11855 Nonsense Available for shipment Available now
sa26471 Nonsense Mutation detected in F1 DNA Not yet available
sa807 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26472
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098446 Nonsense 314 720 12 20
ENSDART00000131515 Nonsense 268 733 8 17
Genomic Location (Zv9):
Chromosome 5 (position 27305842)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25061140
GRCz11 5 25661293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGCTTCATAATAAATTCAGCAATTTAACAGGAGGCTATTGTGGAGGAG[C/T]AAGAGAGCAGAAAAGATGACAACATCCACCTGACAAGATTCCTCAGAGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8186
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098446 Nonsense 365 720 12 20
ENSDART00000131515 Nonsense 319 733 8 17
Genomic Location (Zv9):
Chromosome 5 (position 27305687)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25060985
GRCz11 5 25661138
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGTAGTACGCAGGTCTCAGAAGTTTGCACTGGAGGGCCTGGAGAACTA[C/A]GGCTGGTGGGAGAGRAATGAGGTGAGACCYRTGAAGCAGRGCACGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40426
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098446 Nonsense 397 720 13 20
ENSDART00000131515 Nonsense 351 733 9 17
Genomic Location (Zv9):
Chromosome 5 (position 27305514)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25060812
GRCz11 5 25660965
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAATGTTCTGCCCGATGCTGTTCGATGTGATCAGCACTTTGGAGAACTA[T/A]CACCCACGCATTGCCCTCCAGTGGCAGCTGGGACGCATCTTTGCTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11855
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098446 Nonsense 557 720 17 20
ENSDART00000131515 Nonsense 511 733 13 17
Genomic Location (Zv9):
Chromosome 5 (position 27302864)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25058162
GRCz11 5 25658315
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGTTAATCTGTGTGTTTGTTTCAGGATGGGTGCATTCTACGCWCCATG[T/A]CTTCCAGCACTAAATCTTCTTCGTCTTCACGTGTCTATGTACCTGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26471
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098446 Nonsense 692 720 19 20
ENSDART00000131515 Nonsense 646 733 15 17
Genomic Location (Zv9):
Chromosome 5 (position 27300825)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25056123
GRCz11 5 25656276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTACCTGCAGTCCACTTCGAAAACGTATAAAAGAGTAAACATGGAGCTG[A/T]AAAAGAAACTTCAAGCAGTAAGTTCAAACCTTAGATTTCAAACGGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa807
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098446 Nonsense 698 720 20 20
ENSDART00000131515 Nonsense 652 733 16 17
Genomic Location (Zv9):
Chromosome 5 (position 27298017)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25053315
GRCz11 5 25653468
KASP Assay ID:
554-0712.1 (used for ordering genotyping assays)
KASP Sequence:
AAAAANTCAACAGGTCATGTTTAGTCATATATCCAATTTTGTATTGACAG[C/T]AAAATGAGGAAAACAAGAAAAAGAACAAACTTGCAGCCTTAAAAGCAGCC
Associated Phenotype:
Not determined