Busch Lab

ZMP

ifi30

Ensembl ID:
ENSDARG00000056378
ZFIN ID:
ZDB-GENE-030131-8447
Description:
interferon gamma inducible protein 30 [Source:RefSeq peptide;Acc:NP_001006057]
Human Orthologue:
IFI30
Human Description:
interferon, gamma-inducible protein 30 [Source:HGNC Symbol;Acc:5398]
Mouse Orthologue:
Ifi30
Mouse Description:
interferon gamma inducible protein 30 Gene [Source:MGI Symbol;Acc:MGI:2137648]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39829 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17401 Nonsense Available for shipment Available now
sa19758 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39829
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078866 Essential Splice Site 45 255 None 7

The following transcripts of ENSDARG00000056378 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24532389)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25107166
GRCz11 2 24762800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGCCTTCACAATGGTGCAGCTCCGAGGACATAGCAGCTGAATGTGGGG[T/C]AAGAGTGACTCCTGTACCAAAACAAATGTAACTTTAGCAACCTTTTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17401
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078866 Nonsense 53 255 2 7

The following transcripts of ENSDARG00000056378 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24532819)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25107596
GRCz11 2 24763230
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTACTGTTCCCTTTATTCTCATTTAAGGTGCTGGAACAATGCATGAAGTA[T/G]AACTCGACAAAGGCCGCTGACAAGGTGAAAGTGAGCCTCTACTATGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19758
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078866 Nonsense 72 255 2 7

The following transcripts of ENSDARG00000056378 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24532876)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25107653
GRCz11 2 24763287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAGGCCGCTGACAAGGTGAAAGTGAGCCTCTACTATGAATCTCTGTG[C/A]CCAGGATGCAGAATGTTTCTTACATCTCAGCTCGTGCCAACCTTGATTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25809
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078866 Splice Site, Nonsense 105 255 2 7

The following transcripts of ENSDARG00000056378 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24532973)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25107750
GRCz11 2 24763384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATGTTGCAAGACATCATGGAGATTGATCTGGTTCCATATGGAAACGCA[C/T]AGGTATATTTACACTACTGCACGCCGCTCTTTAGGCAGTTTACTTATAGT
Associated Phenotype:
Not determined