Busch Lab

ZMP

ufsp2

Ensembl ID:
ENSDARG00000056369
ZFIN ID:
ZDB-GENE-030131-8726
Description:
Ufm1-specific protease 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7T347]
Human Orthologue:
UFSP2
Human Description:
UFM1-specific peptidase 2 [Source:HGNC Symbol;Acc:25640]
Mouse Orthologue:
Ufsp2
Mouse Description:
UFM1-specific peptidase 2 Gene [Source:MGI Symbol;Acc:MGI:1913679]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1746 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1746
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078848 Nonsense 119 401 5 11
ENSDART00000122670 Nonsense 184 466 6 12
ENSDART00000148322 Nonsense 119 401 7 13

The following transcripts of ENSDARG00000056369 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16450581)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17015749
GRCz11 1 17708686
KASP Assay ID:
554-1739.1 (used for ordering genotyping assays)
KASP Sequence:
GAGGCATTAAATAAGCAGATAGCAGATATGGAGGAGGTGGTCCTCCGGTA[T/G]AGGAAGGGCTCCTCGTTCCTGGTGCCACAGCCATTTCACTTTCAGCTGCC
Long Flanking Sequence:
TACTGAATGTGTGTGAATGAGTGTGTATGGATGGTTCCCAGTGATGGGTTGCAGCTGGATGGGCAAACGCTGTGTAAAACATATGCTGGATAAGTTGACGGTTCATTCAGCTGTGGCGACCCCAAAATGATAAAGGGACTAAGCCGAAAAGAAAATGAATAAAAGAATGCAAATTTTATTATTTTGTTGTTTGTGAGGCACTTTGAGTTGCATGTTTGAAAAGTGCTATACAAATAAAATTTATTATTATTATTATCAAGCACCTAACAGTGGACAATTTGCATTGAAACTGATGTGAAATATGTTTCTTCTAATGACTTTTTTTTTCGTCAGTCTCGTTTTTAATGACACTTTCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCTCTGTCGCTGTGATTGTTCAGTGTCTTTACAGGTCTGGTGGAGGCATTAAATAAGCAGATAGCAGATATGGAGGAGGTGGTCCTCCGGTA[T/G]AGGAAGGGCTCCTCGTTCCTGGTGCCACAGCCATTTCACTTTCAGCTGCCCAAACCAGCTGGACTCACCACTGTGATCTACCCTGCAGGAGTGCCAGACAGTCAGCTACAGGCTGTCAGAGAGGCAAGTTATACGCAGATTCAGATGATTTTATGGAAGAAAAGAAATTGAATAGGAAATATTATATATAAAGTCAACAGAATAGAGAATAGACAAAGACGTGATTGTTATTTTTAATACATGTACCATGATCAGCATATATTAGTACACCAGTCACAAATCATTGATGAATCATCATTTAAATCAATAGTTTCTATAGGATGCTTTACAATATTATATTTGTGGATATATATTAGTGTAGTCAGAACTGAAGCCATATCTGATCTAATCTTACAAAATAAACTTACCACAACAGTCCAAAAATTAACAGCCTAAATTTATATGTTAGGGAAAAAAATCAAATAGAAATTTTAAAAAGAACAAAAATCAACAGAAACAAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4838
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078848 Nonsense 251 401 7 11
ENSDART00000122670 Nonsense 316 466 8 12
ENSDART00000148322 Nonsense 251 401 9 13

The following transcripts of ENSDARG00000056369 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16444581)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17009749
GRCz11 1 17702686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATATCGTTCCCTTCAGACCATCTGCTCTTGGTTCCAGCAGCAAGGATA[T/A]GTGGAGACAGCTGTTCCCACACACACGCAGATCCAGCAGGTAAGATAAAC
Long Flanking Sequence:
AATGTGATGCATTGTTGACACATTATTTAAAACATGAATTTAAATGAGGCAAGTAAAAATAGTGTCCACTTACCATTAGAAAAAAAATCGTAGTGTTTTGCTGTGTATAATTCTGAAAGTTAATTCATAATGGTCTTAATAAGTCTTAAATTTGACTATGTGAAACCCTGATTCCAAAGTCATCTTAAAAAAAAATCACCTTTGCTTTGTTTACTTCTTAAATGATGAAAGTCAGATTGATGACATAGACTAAAGAAAATTATTTCAGAGGGAGTAAAAAAAATAATTGGTAGGGTTTAGGACTTTAAGTGTTTAAAATCTGTTGCTTCCAATAGTAAAGATTAACGATTGACACTTACTCTTGTCTTTCTGTAGCTGTATTTAGTGCAGGGTGTGTACAGTTATCACCACTACATGCAGGATCGTGTGGATGACGATGGCTGGGGATGTGCATATCGTTCCCTTCAGACCATCTGCTCTTGGTTCCAGCAGCAAGGATA[T/A]GTGGAGACAGCTGTTCCCACACACACGCAGATCCAGCAGGTAAGATAAACTGTCTCTGGATGGAACGGTGTTAAAGTTATGTGGTCTTGTTATATGGATTTAAGAGAAAACTTACATTTGGTTTGTCAGGCTCTTGTGGATGTTGGGGATAAAGAGCCACGTTTTGTGGGTTCACGTCAGTGGATCGGCTCCATTGAAGTTCAGGCTGTCCTTAACCAATTACTGGGCGTCACCTCAAAGATTATGTTTGTCAGGTAGCTAAGATGTTTACCATTTAGCGTGGTGTTTATTCATTTTTAAATATCCAGGTATATTTTTCTGTAGTTTTTTTTATCATGTTGTTCCACATGTTTGCCTATTGTTATGGATTGTATTTTTTCCCATATAATTTTATTCTTTTTCTTATTGTCAAGTGTCGATCAAATATATTTGTACAATTTGATTTAAAAAATTGTTTTTAATATCAAGCAGGATAAGTTGAATAGAATTGAATGAGAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25556
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078848 Nonsense 301 401 8 11
ENSDART00000122670 Nonsense 366 466 9 12
ENSDART00000148322 Nonsense 301 401 10 13

The following transcripts of ENSDARG00000056369 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16444343)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17009511
GRCz11 1 17702448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCCATTGAAGTTCAGGCTGTCCTTAACCAATTACTGGGCGTCACCTCA[A/T]AGATTATGTTTGTCAGGTAGCTAAGATGTTTACCATTTAGCGTGGTGTTT
Long Flanking Sequence:
GATGACATAGACTAAAGAAAATTATTTCAGAGGGAGTAAAAAAAATAATTGGTAGGGTTTAGGACTTTAAGTGTTTAAAATCTGTTGCTTCCAATAGTAAAGATTAACGATTGACACTTACTCTTGTCTTTCTGTAGCTGTATTTAGTGCAGGGTGTGTACAGTTATCACCACTACATGCAGGATCGTGTGGATGACGATGGCTGGGGATGTGCATATCGTTCCCTTCAGACCATCTGCTCTTGGTTCCAGCAGCAAGGATATGTGGAGACAGCTGTTCCCACACACACGCAGATCCAGCAGGTAAGATAAACTGTCTCTGGATGGAACGGTGTTAAAGTTATGTGGTCTTGTTATATGGATTTAAGAGAAAACTTACATTTGGTTTGTCAGGCTCTTGTGGATGTTGGGGATAAAGAGCCACGTTTTGTGGGTTCACGTCAGTGGATCGGCTCCATTGAAGTTCAGGCTGTCCTTAACCAATTACTGGGCGTCACCTCA[A/T]AGATTATGTTTGTCAGGTAGCTAAGATGTTTACCATTTAGCGTGGTGTTTATTCATTTTTAAATATCCAGGTATATTTTTCTGTAGTTTTTTTTATCATGTTGTTCCACATGTTTGCCTATTGTTATGGATTGTATTTTTTCCCATATAATTTTATTCTTTTTCTTATTGTCAAGTGTCGATCAAATATATTTGTACAATTTGATTTAAAAAATTGTTTTTAATATCAAGCAGGATAAGTTGAATAGAATTGAATGAGAACACATGGAAATATTGATACATTTGGTTACAATGGCTATGGTGCTTTTGTGTGAAAGTAGATAGGTCATGGAAATTTCAGCTTTTTACTCAGTGAAAATCAGGGAAAAGTGTGGGAACCCTATGTGTAGTGCTTTTTTTCCATAACAAAATCTGATGCAGTTATACTGAAATAGGTTTATAATAGCAATTTCTAATCGGTTGGAATTTTAAAAATGGTTGATTTTTCTGTTAAAGTCAGGG
Associated Phenotype:
Not determined