Busch Lab

ZMP

a2ml

Ensembl ID:
ENSDARG00000056314
ZFIN ID:
ZDB-GENE-090212-1
Description:
alpha-2-macroglobulin-like [Source:RefSeq peptide;Acc:NP_001132951]
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12900 Nonsense Available for shipment Available now
sa10524 Essential Splice Site Available for shipment Available now
sa6372 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12900
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078734 Nonsense 227 1442 7 34
Genomic Location (Zv9):
Chromosome 15 (position 20086454)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21189080
GRCz11 15 21124812
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAGTTATTGTAATACTAACTGTCTTGATTTCTAGTTTTGCCTAAGTTT[G/T]AAGTTACRGTAAAAAAACCAAAGAYAGTGAGTGTWGTTGMGGAGGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10524
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078734 Essential Splice Site 498 1442 13 34
Genomic Location (Zv9):
Chromosome 15 (position 20085053)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21187679
GRCz11 15 21123411
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTTTTNTTCTTTGCAATTTTGTTTATCAGAGTGTCGTCTGTCTGTTTC[A/T]GGTCTTGTCCAGAGGAGTRATYGTTCATCATGGATTTGAGAAGGTTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6372
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078734 Nonsense 1406 1442 33 34
Genomic Location (Zv9):
Chromosome 15 (position 20076031)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21178657
GRCz11 15 21114389
KASP Assay ID:
554-4677.1 (used for ordering genotyping assays)
KASP Sequence:
TCYMTAAAAATGTTGCAATGAATTACCAGATACAAATGAARCAGGTTCTA[C/T]AAGTTAAGAATCTYAAGCCAGCTGTGGTCAAAGTGTATGATTACTACCAA
Associated Phenotype:
Not determined