Busch Lab

ZMP

smndc1

Ensembl ID:
ENSDARG00000056235
ZFIN ID:
ZDB-GENE-030131-614
Description:
Survival of motor neuron-related-splicing factor 30 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV80]
Human Orthologue:
SMNDC1
Human Description:
survival motor neuron domain containing 1 [Source:HGNC Symbol;Acc:16900]
Mouse Orthologue:
Smndc1
Mouse Description:
survival motor neuron domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1923729]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42907 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15892 Nonsense Available for shipment Available now
sa14965 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42907
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031547 Essential Splice Site None 237 1 6
Genomic Location (Zv9):
Chromosome 17 (position 20068268)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20218279
GRCz11 17 20238115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATCATCTGTTTTTTATATATAAATAGTATACTCGGAATATTTAAAGG[T/A]AAGCCTTATGCTACAGAATGATCCTGTATTCCTGTTTATAATCATATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15892
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031547 Nonsense 95 237 4 6
Genomic Location (Zv9):
Chromosome 17 (position 20071583)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20221594
GRCz11 17 20241430
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACCTGCTTACAGTGGTGTGTGATTAACAGGGTGTATGAGGCAGAAATT[G/T]AGGAGATTGACAATGAGAAYGGCACAGCAGCYATCACCTTCGCTGGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14965
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031547 Essential Splice Site 141 237 4 6
Genomic Location (Zv9):
Chromosome 17 (position 20071724)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20221735
GRCz11 17 20241571
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAGGAGGGCCGGATAAGGGACGAGATAGATGGAAAACCCAAATCCAAG[T/C]AAGTACATTTTCAAGKTAMATGGAAATTAMGTTGCATATAATWGAATTAC
Associated Phenotype:
Not determined