Busch Lab

ZMP

tnika

Ensembl ID:
ENSDARG00000056218
ZFIN ID:
ZDB-GENE-030131-3767
Description:
TRAF2 and NCK interacting kinase a [Source:RefSeq peptide;Acc:NP_955997]
Human Orthologue:
TNIK
Human Description:
TRAF2 and NCK interacting kinase [Source:HGNC Symbol;Acc:30765]
Mouse Orthologue:
Tnik
Mouse Description:
TRAF2 and NCK interacting kinase Gene [Source:MGI Symbol;Acc:MGI:1916264]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa32926 Nonsense Mutation detected in F1 DNA Not yet available
sa19764 Nonsense Available for shipment Available now
sa25812 Nonsense Mutation detected in F1 DNA Not yet available
sa39838 Nonsense Mutation detected in F1 DNA Not yet available
sa8613 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32926
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 321 1303 11 31
Genomic Location (Zv9):
Chromosome 2 (position 25919983)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26116179
GRCz11 2 25771813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGAAATGTGACTGCTGAATGTTTTCACACCTACAGATGAGACGGAGTA[T/A]GAGTACAGCGGGAGTGAAGAGGAGGAAGAGGCCATGCTTGAGATTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19764
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 373 1303 12 31
Genomic Location (Zv9):
Chromosome 2 (position 25920230)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26116426
GRCz11 2 25772060
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGCCTGCAGGTGGCCAATAAGGAGCGTTCAGACGCCCTGCGTAGACAA[C/T]AGCTTGAGCAGCAGCAGAACGAGGGACACAAACATCAACTGCTGGCAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6843
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 785 1303 20 31
Genomic Location (Zv9):
Chromosome 2 (position 25941842)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26138038
GRCz11 2 25793672
KASP Assay ID:
554-5117.1 (used for ordering genotyping assays)
KASP Sequence:
TGACTGCCCTGGCTAAAGAACTGAGGGAGCTGCGAATAGATGAGGTCAGT[C/T]GACCCCCTCTTAAACTCACAGACTACTCCTCTTCTAGTGAGGACTCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25812
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 1064 1303 26 31
Genomic Location (Zv9):
Chromosome 2 (position 25946824)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26143020
GRCz11 2 25798654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGGAAAAAAAATAAGCTCCGTGTGTACTACTTGTCATGGCTAAGAAAC[C/T]GAATACTGCACAATGACCCGGAGGTGGAGAAGAAGCAGGGCTGGATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39838
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Nonsense 1148 1303 28 31
Genomic Location (Zv9):
Chromosome 2 (position 25948999)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26145195
GRCz11 2 25800829
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGCACAGACCTCAGCTGGTGGACCTCACAGTAGAAGAGGGTCAGAGGT[T/G]AAAGGTCATCTACGGCTCTAGTGTGGGCTTTCACGTCATCGATGTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8613
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051234 Essential Splice Site 1177 1303 29 31
Genomic Location (Zv9):
Chromosome 2 (position 25952592)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26148788
GRCz11 2 25804422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTACTGGTCTCCTTTAGCACTGCAGCCTGTAACATCTTTTTTTCWTCCTT[A/T]GATTCAGAGCACTGTGACTCCTCATGCCATCGTGGTGCTTCCGAAGACTG
Associated Phenotype:
Not determined