Busch Lab

ZMP

abcb9

Ensembl ID:
ENSDARG00000056200
ZFIN ID:
ZDB-GENE-050517-12
Description:
ATP-binding cassette sub-family B member 9 [Source:RefSeq peptide;Acc:NP_001119906]
Human Orthologue:
ABCB9
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 9 [Source:HGNC Symbol;Acc:50]
Mouse Orthologue:
Abcb9
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 9 Gene [Source:MGI Symbol;Acc:MGI:1861729]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20431 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26482
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078649 Essential Splice Site 467 789 6 11
Genomic Location (Zv9):
Chromosome 5 (position 29667988)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27423286
GRCz11 5 28023439
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTATTTCCTTTGTTATCTACGAGCTGGAACTTGGAGAGGCTCTGGAGG[T/C]ATCATTGTTTTTCTTTTGAAAGGGCTATATGCAATAATTTTAATTTATTA
Long Flanking Sequence:
AGTGTTTTAACACACTTTTGATGTTCAACAGAAATTAACCAAAGAAGTCCAGACGGCACTGGCTCAGGCCAATAAAGTGGCAGAGGAAACTATATCAGCCATGAGAACAGTGCGAAGTTTTGCAAATGAGGATCAGGAAGGAGACATGTACTACAGCAGACTGCAGGAGATGTTCGTTTTAAATAAGAAGCAAGCCATTGCCTATGCCTGCTTCATGTGGTCCAGCTATGTAGGTATCTTTAGTTTAGGTCCTAACAAAATTGTTAGTTATAACGAGTAGTTTTTAGATTTATTGTTTGTAAACATTTCGTAGCATATCAAAAGTAATTTGGAAGTTCAAATTCAAGATATGATTTCTACCATTCTTTAGATTTCTGAGCTGGCCTTACAAGTAGCAATCTTGTTTTATGGAGGCCATCTAGTGGTGACAAATCAGATGAGCGGCGGGACACTTATTTCCTTTGTTATCTACGAGCTGGAACTTGGAGAGGCTCTGGAGG[T/C]ATCATTGTTTTTCTTTTGAAAGGGCTATATGCAATAATTTTAATTTATTAATAATTATTTACCAACAAATCAGAATGTATCATTTAGATGTGTTCCTTGTAGCCTCTTATTGGTTCTATAACACGATAAAAATGCTTAAAATTTTTAAGGTAATGCTGAAAGGCTATTTTGTATTTTAATGTCAATGTGCCAGGCATAGAGAATGGATTAATAAAACATTAGTCTTACATTACATTAGTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATGGGTGGGCCATTTATATGGATACACCTTAATAAACTTATTGGGAATTTCACAAGGAAAAACAATGGTGTGCTTGGATATTTTCAAGCCCCCCATATATACTAATGTGCCACAAACAGGACGTAATATCACCAACCATTCCCATTTTATTAAGGTGTATTCATATAAATGGTCCACTCTGTCATGTGATAAATAAAAAATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20431
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078649 Essential Splice Site 687 789 10 11
Genomic Location (Zv9):
Chromosome 5 (position 29663563)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27418861
GRCz11 5 28019014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTCTGGATGAAGCCACAAGCGCACTGGATTCAGAAAGCGAATACATAG[T/C]AAGCAACGGCTATTACATTTGAAGACTGGCTCTAGTAAACATTTCAGTGT
Long Flanking Sequence:
TCTGTCACTGTGCTGTTTATCTGATGTAACACATGATAATAAGAAGCAGGCATGCACGTGGGAACGGTGGGCGAGGAGAAGTAGCTCGTGTTCGTTTAAGGCCACAGGCTACATAAACAGCTACACTATACTCAGACACCAAAATGGGCTGATTCTGGAGGCTATAATAAATAATCTGATGGGTATTTTAAGCTGAAACGTTACAGACATATTCTGGAAACACCTAAGGCTTGTTTTACATCTTGTATAAACGGTAAAAGAGGTGCCCTTTAAGTCTTTTATTATTTATTTTTTATCTATGGCAGAAACAGACTTTTGTTGAAGCATTTGACTTCTAGCTTACTTGCCTGCTCTGTGCACAGGGGTCGGAGAGAAGGGCACTCAGCTCTCTGGTGGGCAGAAACAGAGAGTTGCCATCGCCCGAGCTCTCATCAGAAGCCCTCGCATTCTCATTCTGGATGAAGCCACAAGCGCACTGGATTCAGAAAGCGAATACATAG[T/C]AAGCAACGGCTATTACATTTGAAGACTGGCTCTAGTAAACATTTCAGTGTTGATTTAGACATCATTCCACTCACTATTTTGTTCCAGGTTCAGCAGGCTCTGAACAACTTGATGCGGGAGCACACAGTTTTAGTGATTGCCCACAGACTGAGCACAGTGGAGAGAGCAGACAACATCCTTGTGATCGACAAAGGCTCTGTGGTGGAGCAGGGCCCTCATGCTGAACTCATGGCCAGAGGAGGCCTCTACTGTAAGCTGGTGCAGAGACAGATCCTGGGCACTGAAATCGATGTAGATGATAAAAACCCATCGCCAGCCCCAACATGGGAGCTAAAGACAGAAGATAAGGAGAATGCAGAGGACTGTAGTGACACAGAGTATGAAACACGCTACTGAGAGCCAATCATTTTGTGCTTTATATGATTATTGGTATGAAGGCCTTAATACTAGATTTGTTTACTTGATCGGATATTGGGATATATCAGATAATGTGCATGTCA
Associated Phenotype:
Not determined