Busch Lab

ZMP

si:ch211-168k14.2

Ensembl ID:
ENSDARG00000056191
ZFIN ID:
ZDB-GENE-070912-149
Description:
Novel protein similar to vertebrate phospholipase D1, phosphatidylcholine-specific (PLD1) [Source:Un
Human Orthologues:
PLD1, PLD2
Human Descriptions:
phospholipase D1, phosphatidylcholine-specific [Source:HGNC Symbol;Acc:9067]
phospholipase D2 [Source:HGNC Symbol;Acc:9068]
Mouse Orthologues:
Pld1, Pld2
Mouse Descriptions:
phospholipase D1 Gene [Source:MGI Symbol;Acc:MGI:109585]
phospholipase D2 Gene [Source:MGI Symbol;Acc:MGI:892877]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa6115 Nonsense Confirmed mutation in F2 line Not yet available
sa45362 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa21513 Nonsense Available for shipment Available now
sa41451 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31724 Essential Splice Site Available for shipment Available now
sa7193 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6115
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Nonsense 120 984 3 32
ENSDART00000133094 Nonsense 126 452 4 13
ENSDART00000140220 None None 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 32574678)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31730624
GRCz11 9 31541370
KASP Assay ID:
554-3888.1 (used for ordering genotyping assays)
KASP Sequence:
TTCACGGAGAACGCATCCCAACATTACCAAGAAGACCTGATGCCCTCGTC[A/T]GAGAGGAACAGCTCATCAGCAGAAAAGTGACTTTTTTTTNNATTTTAATT
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
larval locomotory behavior
GO:0008345
disrupted
PATO:0001507
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
skeletal muscle
ZFA:0005277
quality
PATO:0000001
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa45362
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Splice Site, Nonsense 202 984 7 32
ENSDART00000133094 Splice Site, Nonsense 208 452 8 13
ENSDART00000140220 None None 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 32577753)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31733699
GRCz11 9 31544445
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCCCCCTTGTTTCAGCTCTCATGTGGTGACTGCTTCATGTTTCAGAT[G/A]GCTGGTGGTAAAAGACTCCTTTGTTCTCTACATGAGGCCAGAGGATGGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27424
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Essential Splice Site 332 984 9 32
ENSDART00000133094 Splice Site None 452 None 13
ENSDART00000140220 None None 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 32580421)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31736367
GRCz11 9 31547113
KASP Assay ID:
2260-2005.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGGAAGGAGCAAAGGAGGAAATCTTCATCACAGCCTGGTGGTACAGA[T/A]AAGAATCAGCATCAATTACTCCACATGTACCTAGATTTCATTCTGTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21513
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Nonsense 440 984 12 32
ENSDART00000133094 Nonsense 444 452 13 13
ENSDART00000140220 None None 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 32582846)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31738792
GRCz11 9 31549538
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAGCCTTCCTGGGAGGGATTGATTTGGCTTACGGAAGATGGGACGACTA[C/A]CAACACAGACTGGCTGATGTGGGAAGTGTGAGAAGAAGCCCTCAGCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41451
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Essential Splice Site 523 984 19 32
ENSDART00000133094 None None 452 None 13
ENSDART00000140220 None None 449 None 11
ENSDART00000078631 Essential Splice Site 523 984 19 32
ENSDART00000133094 None None 452 None 13
ENSDART00000140220 None None 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 32588025)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31743971
GRCz11 9 31554717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTAAGAGATTGGTGTATAACACATATTTGTGTGACTAAAATCAACAGAG[T/G]ATTCTTCGGATAGCATAGTGTGAGTACGGCGTTAGTGTCTTTTGCAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31724
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Essential Splice Site 523 984 19 32
ENSDART00000133094 None None 452 None 13
ENSDART00000140220 None None 449 None 11
ENSDART00000078631 Essential Splice Site 523 984 19 32
ENSDART00000133094 None None 452 None 13
ENSDART00000140220 None None 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 32588025)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31743971
GRCz11 9 31554717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTAAGAGATTGGTGTATAACACATATTTGTGTGACTAAAATCAACAGAG[T/G]ATTCTTCGGATAGCATAGTGTGAGTACGGCGTTAGTGTCTTTTGCAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7193
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078631 Essential Splice Site 578 984 None 32
ENSDART00000133094 None None 452 None 13
ENSDART00000140220 Essential Splice Site 43 449 None 11

The following transcripts of ENSDARG00000056191 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 32589478)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31745424
GRCz11 9 31556170
KASP Assay ID:
554-5271.1 (used for ordering genotyping assays)
KASP Sequence:
TGCAACTTCATCCTCAAAGACTGGGTCAAACTCAACAAGCCTTTTGATGG[T/C]ATGTCTACAAAATCACAACCAACAACCTCAGCATCTTCTTTTTAGACCTC
Associated Phenotype:
Not determined