Busch Lab

ZMP

si:ch211-229c8.4

Ensembl ID:
ENSDARG00000056154
ZFIN ID:
ZDB-GENE-050419-129
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQM1]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14126 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29059
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099130 Nonsense 4 843 1 8
ENSDART00000137856 None None 688 None 4
Genomic Location (Zv9):
Chromosome 18 (position 31482342)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33279201
GRCz11 18 33253796
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTAATTTAAGGACATCCTTCAATCACAGATTATCAATATAGGCTGTA[C/A]CTGTTAGATTTGTTAGATTCGTTTCTGTGTCAGTTATGGCAGGAGTTTAT
Long Flanking Sequence:
GGACACCTAAACATATTACCTGTTTTAATCGTATATCTTAATACAATGTCTGTTTACAGCTGTCAACGTCATGTCTTTACCGACACTATTGTGCAAGCGTTTGGTGATTGCTGATTGGCCAACACATTTGACCAGAAAGAAAACCTGACCAATAAAACCCTTTTGCCACACCCCTACCGGAAAAAACTTTCAACCAATGAAAAACCTTTTGCCACACCCCTACCTTTTGCCACGCCTTTTCTCCAGACTGCAGTTACCCATACTAGACTTTTTCTGTCTTTATTATATTTTACAGGAAATCCAAAATGTTTTCACATATGCGATTTGAATTGCACATTGTCTCAAGGATCAGAGTGTATTGGATGTGTAAAATCATTGGTTCAAGCAAGTAATTACATTCCCAAGCTTGGTACATAACAGACTTACACCAGGAGGGGCATACAGTACGCTTGATTAATTTAAGGACATCCTTCAATCACAGATTATCAATATAGGCTGTA[C/A]CTGTTAGATTTGTTAGATTCGTTTCTGTGTCAGTTATGGCAGGAGTTTATAAAGTGTTGATTTCATTTTGGCCACTGCTGTGTATCGGTGTGCAGAGCCAATATAAAAGCAAGGAAAACTGTGTCTTTCAGGGAGATGAAGACACATACAGCTTTTACCAGCGGGGAGATGTGGTTTTGGGAGGAATCTTTCCTTTGCATTCTAGCCCTGTATCATCGCTGTTTTCTTTCAGAACCAAACCTAAGCCAACAAGTTACAAATTGTATGTCATGCTTTCATAAAGTTTTGTCTGAAATTTGTGTGAAATTATGAAATGCCAATGCATGTGTGTGACTTTTTGCAGTTTTACCCCTCGAGCCTTGAGGTGGATGCAGACAATGATCTTTGCTGTGAGAGAAATAAACCAGCGGCAAGATCTTTTACCCAATCTGTCTCTGGGCTACCACATCAGGGACAGCGGTGATGATATACCAGTGTCTGTGAAGAGGTCTCTTCTCCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29058
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099130 Nonsense 354 843 5 8
ENSDART00000137856 Nonsense 191 688 1 4
Genomic Location (Zv9):
Chromosome 18 (position 31480959)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33277818
GRCz11 18 33252413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGACCTCCCATTTCCTCTCTGAGTTTTGGGAAGAGACTTTTCGTTGT[C/T]GACTGAATGGTTCCTTAAACACTCATGCACATGGAGAACAGGCACAAAAC
Long Flanking Sequence:
CAAGTGACCTATTTCAGATTAAGGCTTTGGTAAAACTTATTAATTATTTTCAATGGACATGGGTTGGACTGATAGGTGTGAATTCTGACTATGCTCACTTTGCTATCCAGCTCTTCCTTAAAGAATCAGAACAATTTAATATTTGTCCTGCTTATGTTCACTTTTATCCTGTTGTACTGATGGAAGATGCATTGGAGGAACTTGTGAACATTTTAAAAGCCTCTTCTGCCACAGTCATAATAAATTTTTCTGGAGAATCAGAACTGCATAGTATTCTAAAAGAATGCAGACGTCAAAATGTCACACATCTGCAGTGGATCGCCAGTGAGGCTTGGGCCACATCAAAATCCCTCTGGGAGGAATTTGGTGATCTGCTAAAGGGTACATTGGGTTTTGCCATACATAGAGCTGATATTCCACATCTTGGCAGTTATCTTAAAGAAATAAGACCTCAGACCTCCCATTTCCTCTCTGAGTTTTGGGAAGAGACTTTTCGTTGT[C/T]GACTGAATGGTTCCTTAAACACTCATGCACATGGAGAACAGGCACAAAACTGGCCAGCCTGTAATGGTAGTGAAAATCTGGATAATGTGTACACCACTTATTCAGACGTGTCACAACTCAGAGTCTCCTACAATGTTTACAAAGCTGTGTATCTCATAGCACATGCACTGCATGACATGAGCACATGTGTTCCAGGAAAGGGCCCGTTCCAGAATGGGACATGTGGGAGTCTGTATCAAATTCAGCCATGGCAGGTGTGTGTTTATCACCATTTTATATTCTCTGCCTATATTGTACTGATAAGGAACTATCAAGCAGTGTATACATTTTAACACAATGGTGAAATATAACATCTGTGGAACCTAAATATTTTCCATCAAATAATTGTAATGTTTTTAATATACATCATCCTTTTCCTTAATTATGACTCAAGCTCCTGTACTACATGAAACAAGCAAATTTTACAATCTTAGGAGAAGAGGTCAGATTTGATGAGAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4023
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099130 Nonsense 472 843 6 8
ENSDART00000137856 Nonsense 309 688 2 4
Genomic Location (Zv9):
Chromosome 18 (position 31480424)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33277283
GRCz11 18 33251878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATTTGATGAGAATGGTGATCCTATTGCATCTTATGACCTTATGAACTG[G/A]CAAAGAGGATCCGATAGCTCCCTTCAACTTGTCAGGGTGGGATTCTATGA
Long Flanking Sequence:
AGAACAGGCACAAAACTGGCCAGCCTGTAATGGTAGTGAAAATCTGGATAATGTGTACACCACTTATTCAGACGTGTCACAACTCAGAGTCTCCTACAATGTTTACAAAGCTGTGTATCTCATAGCACATGCACTGCATGACATGAGCACATGTGTTCCAGGAAAGGGCCCGTTCCAGAATGGGACATGTGGGAGTCTGTATCAAATTCAGCCATGGCAGGTGTGTGTTTATCACCATTTTATATTCTCTGCCTATATTGTACTGATAAGGAACTATCAAGCAGTGTATACATTTTAACACAATGGTGAAATATAACATCTGTGGAACCTAAATATTTTCCATCAAATAATTGTAATGTTTTTAATATACATCATCCTTTTCCTTAATTATGACTCAAGCTCCTGTACTACATGAAACAAGCAAATTTTACAATCTTAGGAGAAGAGGTCAGATTTGATGAGAATGGTGATCCTATTGCATCTTATGACCTTATGAACTG[G/A]CAAAGAGGATCCGATAGCTCCCTTCAACTTGTCAGGGTGGGATTCTATGATGCTTCCCTTGAAGATGACAAGGACCTAGTGGTAGAGGAGTCAGTAATTATGTGGCACAGAGCAGAGAAGGTGTGTGCCATCCCACGCATCACTAGATATTGGTCTCTAAGTTTGTTTTTCCTTCAGCTCTATTTTATGATTTTGACTGGACTAAATAAAATGGAGTATTGTAACTTTAAATGGAAATGCAATATTGGTTTCATTATGCACTAAACAATTGTAAACAAAATATGTTAAAATGTGTAATAATGTAGAGAACATTATAAATGACTTCAGATTTTAAATTTATATGTATCTGTTTGCAAATTTACATTGTAATATGCACTCACATAAAGTTTAGACACATTTCTACTGCACTGTCTGTTGTTGTCATTAGGCACCAAAATCAATGTGTAGTCAAAGTTGTCTGCCGGGCACCAGAAAGGCCAGGCAAAAAGGAAAGCCAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14126
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099130 Nonsense 552 843 7 8
ENSDART00000137856 Nonsense 389 688 3 4
Genomic Location (Zv9):
Chromosome 18 (position 31479879)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33276738
GRCz11 18 33251333
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTCTGCTGCTTTGACTKTATATCATGTGCTGAAGGAGAGATCAGTAAT[C/T]AGACAGGTGTGAATTTCTTCCCTNNTTGTCACTTAATTACATTTTTTTNNNAA
Long Flanking Sequence:
CTATGATGCTTCCCTTGAAGATGACAAGGACCTAGTGGTAGAGGAGTCAGTAATTATGTGGCACAGAGCAGAGAAGGTGTGTGCCATCCCACGCATCACTAGATATTGGTCTCTAAGTTTGTTTTTCCTTCAGCTCTATTTTATGATTTTGACTGGACTAAATAAAATGGAGTATTGTAACTTTAAATGGAAATGCAATATTGGTTTCATTATGCACTAAACAATTGTAAACAAAATATGTTAAAATGTGTAATAATGTAGAGAACATTATAAATGACTTCAGATTTTAAATTTATATGTATCTGTTTGCAAATTTACATTGTAATATGCACTCACATAAAGTTTAGACACATTTCTACTGCACTGTCTGTTGTTGTCATTAGGCACCAAAATCAATGTGTAGTCAAAGTTGTCTGCCGGGCACCAGAAAGGCCAGGCAAAAAGGAAAGCCAGTCTGCTGCTTTGACTGTATATCATGTGCTGAAGGAGAGATCAGTAAT[C/T]AGACAGGTGTGAATTTCTTCCCTCTTTGTCACTTAATTACATTTTTTTAAGAAAAACGTCAATAAATAAACAATACAAATACATTTTATCTTTCACCTATTCATTTATTTTTACAGACTCAATTGATTGCTTGACATGCTCAAAAGAAACGTGGCCTAACCAAGCCCAAGACCGGTGCATCCCCAAAACTTTAGAGTTTTTGTCCTTTCAGGAGCCCTTGGGAATAATTCTTTGGGTATTTTCAGCATTCGGGGCCTGTGCAGCATTAGCAGTGCTCTGTGTGTTTGTAATGTATAGGAAGACTCCAGTTGTACGTGGAAACAATATAGAGTTAAGTTTCCTTCTCCTCTTGTTCCTCTGTGCTTGTTTTTTGATTGGCCTAACATTTTTAGGGAAGCCAACTGATTGGCTATGCCAAATTCGCTATCCAGCTTTTGGAATCAGCTTTACACTCTGTATTTCATGCATCTTGGCAAAAACTGTGGTCGTTTTAATGGCTT
Associated Phenotype:
Not determined