Busch Lab

ZMP

si:dkey-159a18.1

Ensembl ID:
ENSDARG00000056145
ZFIN ID:
ZDB-GENE-041210-204
Description:
Novel protein similar to vertebrate sortilin 1 (SORT1) [Source:UniProtKB/TrEMBL;Acc:Q5RGI7]
Human Orthologue:
SORT1
Human Description:
sortilin 1 [Source:HGNC Symbol;Acc:11186]
Mouse Orthologue:
Sort1
Mouse Description:
sortilin 1 Gene [Source:MGI Symbol;Acc:MGI:1338015]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20265 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20265
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078587 Essential Splice Site 762 805 20 21
ENSDART00000134528 None None 279 None 6
Genomic Location (Zv9):
Chromosome 4 (position 19046097)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20122703
GRCz11 4 20111679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTGTATATTACATACTAAAGATTTCTCGTCAACTTCTGCCTCCTGCA[G/A]GTCGCCGGAATATAACTTTTCTGTTCTGCAAATCCAAGAAGACGACCTGT
Long Flanking Sequence:
GTACACATATTACACTGTTATAATAATAAATTTTTTATAGATATCGCAGGATTCCCGGAGATAAATGTAAGGGGAGTTTCAGCCCTCCAAGAAATGAAGAGGCTCACCAAAAGCTTTGTGGGAATGTCACTTCCTCAGATTCACATACAGAGATACCAGTGAGTGGTCCATTTCTCATAAGAATAATAAGTTACTATACAGTGGCCAAAAAAACACAGATATTCATTGTTGTGTAGAGAATAAAATTAATCCAATAAAGGAATTTTTTGTCTTATGATTTGCAGCCAGCCATACTGGCTCTTATAGTGGTGTGTAGTTTGGGCATCATTTGTTTGGTTATTATAGCAGCTTACATGATCACTTCAAGAAGAATAAACTGTGGCCAAAGGTAAGGTCATTTGATAAAGCCTTGTCCAGCTTTTGTTTTATGTTACATCCATTTGAAACTATTGTCTGTATATTACATACTAAAGATTTCTCGTCAACTTCTGCCTCCTGCA[G/A]GTCGCCGGAATATAACTTTTCTGTTCTGCAAATCCAAGAAGACGACCTGTCCGTTAACAATGAAAGCACCCCCAATGGCAAACTAAACGGTTTCCAGGTCCAGGAGGACTCAGATGATGTGAGCTTGATCAAACAATAATATCATGCCTCCATTTAGTTAATGGCTATTGTAATAATTAACCTAAAAACCTACTTAATCTTCTTACACTCGTTATTCCAACCTTTGTGCTTTGTTTTTTATTTTGTAGGAAGTACTTTTTTAAAAATAATTTATTGCATTTGTTTGCTTTTATTTTTCTCTATTTTTCTTTCTTTCTTTTTTCTTTTCTTTTTTGGTCTTCTTTAGGATCTCCTTGAATGAACAACATTTAAACTGTGGAAACTACTCAGGCTTTGAAAACAGGTGTTTGCAGGCAGATATGCTTCAAATAAATTTCAAGCCTAGTCACTGTAACTGGAAGATAAAACACCTGAAAATAATAGTGAACTGCATTTATCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26291
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078587 Essential Splice Site 801 805 20 21
ENSDART00000134528 None None 279 None 6
Genomic Location (Zv9):
Chromosome 4 (position 19045978)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20122584
GRCz11 4 20111560
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCCAATGGCAAACTAAACGGTTTCCAGGTCCAGGAGGACTCAGATGAT[G/T]TGAGCTTGATCAAACAATAATATCATGCCTCCATTTAGTTAATGGCTATT
Long Flanking Sequence:
GGGAATGTCACTTCCTCAGATTCACATACAGAGATACCAGTGAGTGGTCCATTTCTCATAAGAATAATAAGTTACTATACAGTGGCCAAAAAAACACAGATATTCATTGTTGTGTAGAGAATAAAATTAATCCAATAAAGGAATTTTTTGTCTTATGATTTGCAGCCAGCCATACTGGCTCTTATAGTGGTGTGTAGTTTGGGCATCATTTGTTTGGTTATTATAGCAGCTTACATGATCACTTCAAGAAGAATAAACTGTGGCCAAAGGTAAGGTCATTTGATAAAGCCTTGTCCAGCTTTTGTTTTATGTTACATCCATTTGAAACTATTGTCTGTATATTACATACTAAAGATTTCTCGTCAACTTCTGCCTCCTGCAGGTCGCCGGAATATAACTTTTCTGTTCTGCAAATCCAAGAAGACGACCTGTCCGTTAACAATGAAAGCACCCCCAATGGCAAACTAAACGGTTTCCAGGTCCAGGAGGACTCAGATGAT[G/T]TGAGCTTGATCAAACAATAATATCATGCCTCCATTTAGTTAATGGCTATTGTAATAATTAACCTAAAAACCTACTTAATCTTCTTACACTCGTTATTCCAACCTTTGTGCTTTGTTTTTTATTTTGTAGGAAGTACTTTTTTAAAAATAATTTATTGCATTTGTTTGCTTTTATTTTTCTCTATTTTTCTTTCTTTCTTTTTTCTTTTCTTTTTTGGTCTTCTTTAGGATCTCCTTGAATGAACAACATTTAAACTGTGGAAACTACTCAGGCTTTGAAAACAGGTGTTTGCAGGCAGATATGCTTCAAATAAATTTCAAGCCTAGTCACTGTAACTGGAAGATAAAACACCTGAAAATAATAGTGAACTGCATTTATCAACCTGAGCTCTTGTTTTGTCCTATCAAGTGTATTATGCAAGTATCTGAGGATAATGCATGTATCATTGAAAGTGAATTTACTTTCACCCTCTCTGTCTTTTGCACTGGACTCATTCATAT
Associated Phenotype:
Not determined