Busch Lab

ZMP

kitb

Ensembl ID:
ENSDARG00000056133
ZFIN ID:
ZDB-GENE-050916-2
Description:
kit receptor b [Source:RefSeq peptide;Acc:NP_001137390]
Human Orthologue:
KIT
Human Description:
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog [Source:HGNC Symbol;Acc:6342]
Mouse Orthologue:
Kit
Mouse Description:
kit oncogene Gene [Source:MGI Symbol;Acc:MGI:96677]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15348 Nonsense Available for shipment Available now
sa9136 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32649 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15348
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044030 Nonsense 197 957 3 21
ENSDART00000103093 None None 279 3 21
ENSDART00000123777 Nonsense 197 936 3 20

The following transcripts of ENSDARG00000056133 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18239168)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18804336
GRCz11 1 19497273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNNNNNNNNATCTGYGCCGGACAACTGGATCAAAAACCTGTCAAATCCAGAGAGTA[T/A]AACTTGGTTGTGCGGCTAGGTGAGTGAGTRGTARAGCAGTGGCTCTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9136
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044030 Essential Splice Site 204 957 None 21
ENSDART00000103093 Essential Splice Site None 279 None 21
ENSDART00000123777 Essential Splice Site 204 936 None 20

The following transcripts of ENSDARG00000056133 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18239147)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18804315
GRCz11 1 19497252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCAAAAACCTGTCAAATCCAGAGAGTATAACTTGGTTGTGCGGCTAGG[T/C]GAGTGAGTRGTARAGCAGTGGCNNNNNNNNNNATAGTTCACCAAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25561
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044030 Nonsense 370 957 7 21
ENSDART00000103093 None None 279 7 21
ENSDART00000123777 Nonsense 370 936 7 20

The following transcripts of ENSDARG00000056133 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18233114)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18798282
GRCz11 1 19491219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCTAATATAAGCCTTGTGCATTGTTGTTTGTCGGAATGTTTCAGGTA[C/A]ATCAGTGAACTGAGGCTGGTTCGAGTTCATGGATCAGAAGGCGGGATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32649
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044030 Nonsense 514 957 10 21
ENSDART00000103093 None None 279 10 21
ENSDART00000123777 Nonsense 514 936 10 20

The following transcripts of ENSDARG00000056133 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18227497)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18792665
GRCz11 1 19485602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAATGTGTTGATATGTTTTTTGTCTATAAAGAGAGAACCGTGCCTCAT[A/T]AACTCTTCACACCGCTGCTATCTGGGGTTGTGTCCACTTCTGTTTTGCTT
Associated Phenotype:
Not determined