Busch Lab

ZMP

si:dkey-12h9.7

Ensembl ID:
ENSDARG00000056089
ZFIN ID:
ZDB-GENE-041001-146
Description:
nuclear receptor-binding protein [Source:RefSeq peptide;Acc:NP_001038654]
Human Orthologue:
NRBP1
Human Description:
nuclear receptor binding protein 1 [Source:HGNC Symbol;Acc:7993]
Mouse Orthologue:
Nrbp1
Mouse Description:
nuclear receptor binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2183436]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa25137 Nonsense Mutation detected in F1 DNA Not yet available
sa6634 Nonsense Mutation detected in F1 DNA Not yet available
sa37037 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa29368 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25137
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078518 Nonsense 45 535 2 18
ENSDART00000147845 Nonsense 29 519 2 18
Genomic Location (Zv9):
Chromosome 20 (position 26033823)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26105126
GRCz11 20 26004216
KASP Assay ID:
554-7357.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGACAGGGGGTTTCATCGGTGTCTCCACCGGTGTCCACAGTAACA[C/T]AGCCTGCACCGTCTGCTACTGAGGATGAGGAGGAAGAGAGTGAAGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6634
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078518 Nonsense 92 535 3 18
ENSDART00000147845 Nonsense 76 519 3 18
Genomic Location (Zv9):
Chromosome 20 (position 26035500)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26106803
GRCz11 20 26005893
KASP Assay ID:
554-4332.1 (used for ordering genotyping assays)
KASP Sequence:
TACCCCCAACAGGTTAACCAGCGAAATGTCCCAGGTATCGACAATGCTTA[T/A]CTTGCCATGGACACTGAAGAAGGTGTGGAGGTGGTGTGGAATGAGGTCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4902
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078518 Essential Splice Site 446 535 14 18
ENSDART00000147845 Essential Splice Site 430 519 14 18
Genomic Location (Zv9):
Chromosome 20 (position 26043431)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26114734
GRCz11 20 26013824
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCGTCAAAACACCCACGCCTGAGCCCGCAGAGCTGGAGACCAGGAAGG[T/A]GAGAAATAGACTGATTTAAGGAGACATTGACCAAGTATTGAAAATTAARG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37037
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078518 Essential Splice Site 486 535 16 18
ENSDART00000147845 Essential Splice Site 470 519 16 18
Genomic Location (Zv9):
Chromosome 20 (position 26046808)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26118111
GRCz11 20 26017201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTGGAAGATAAGCTGAACCGACACTTGAGTTGTGATTTGGCACCAAG[T/A]GAGTATTTTATCAGGCCTCAAACAAACTCTACACAACTATGTAAACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29368
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078518 Essential Splice Site 504 535 17 18
ENSDART00000147845 Essential Splice Site 488 519 17 18
Genomic Location (Zv9):
Chromosome 20 (position 26047766)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26119069
GRCz11 20 26018159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTACAGGAGTTGGCTGTGGAACTGGTCCAGCTTGGTTTCATTAGTGAGG[T/C]AAGAAGCTTCATTTAGATGTGCTGAACACAACAATTTTTAAATGTTTTAC
Associated Phenotype:
Not determined