Busch Lab

ZMP

si:dkey-191g9.5

Ensembl ID:
ENSDARG00000056080
ZFIN ID:
ZDB-GENE-090313-217
Description:
Novel protein similar to vertebrate RAP1, GTP-GDP dissociation stimulator 1 (RAP1GDS1) [Source:UniPr
Human Orthologue:
RAP1GDS1
Human Description:
RAP1, GTP-GDP dissociation stimulator 1 [Source:HGNC Symbol;Acc:9859]
Mouse Orthologue:
Rap1gds1
Mouse Description:
RAP1, GTP-GDP dissociation stimulator 1 Gene [Source:MGI Symbol;Acc:MGI:2385189]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa35465 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31921 Nonsense Available for shipment Available now
sa38934 Nonsense Mutation detected in F1 DNA Not yet available
sa22277 Nonsense Available for shipment Available now
sa1446 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa35465
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Essential Splice Site 80 560 3 14
Genomic Location (Zv9):
Chromosome 13 (position 21871560)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21600898
GRCz11 13 21731348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCACTCACCTCTCAGGTCACTTTACTGGTGGCAGAGATGGCCAGAGAAG[G/A]TAAAAACAACTATTATTATTGTTATTATTCATTTATTAATTCATTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31921
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Nonsense 193 560 6 14
Genomic Location (Zv9):
Chromosome 13 (position 21865683)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21595021
GRCz11 13 21725471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGGCTGAGGTTTTGACCCATCAGCTGAAACGGGCTCCAGATGCAGAA[C/T]GACGGCATCTCATACTAGAGGTTCTTGGTTCACTGGGAGAAAGTGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38934
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Nonsense 258 560 8 14
Genomic Location (Zv9):
Chromosome 13 (position 21863820)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21593158
GRCz11 13 21723608
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGCAGATTATTTGTTTTGAGCTTGATCTGCATTTCATTACAGATGAAT[C/A]AATGCAGAAATGTTTTGGAGAAGGGACGGGGATGGTGTATCAGGATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22277
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Nonsense 271 560 8 14
Genomic Location (Zv9):
Chromosome 13 (position 21863780)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21593118
GRCz11 13 21723568
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGATGAATCAATGCAGAAATGTTTTGGAGAAGGGACGGGGATGGTGTA[T/A]CAGGATGTTCTCGCTTGGCTGCAGTCATCAAACACTGAGCTGCAGCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1446
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078460 Essential Splice Site 519 560 14 14
Genomic Location (Zv9):
Chromosome 13 (position 21852797)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21582135
GRCz11 13 21712585
KASP Assay ID:
554-1372.1 (used for ordering genotyping assays)
KASP Sequence:
ACCCAAAACTAATTTATAACCTCCTAATTACATTTCTGTTCTCTCCTACA[G/A]CCATACTAAGGGAGCAGATAACATCTCTAAACCTGAGGGACACCCTGTCC
Associated Phenotype:
Not determined