Busch Lab

ZMP

rangap1

Ensembl ID:
ENSDARG00000056059
ZFIN ID:
ZDB-GENE-040426-1921
Description:
Ran GTPase activating protein 1 [Source:RefSeq peptide;Acc:NP_998154]
Human Orthologue:
RANGAP1
Human Description:
Ran GTPase activating protein 1 [Source:HGNC Symbol;Acc:9854]
Mouse Orthologue:
Rangap1
Mouse Description:
RAN GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:103071]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35260 Essential Splice Site Available for shipment Available now
sa31872 Essential Splice Site Available for shipment Available now
sa14788 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35260
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078484 Essential Splice Site None 576 None 16
ENSDART00000142253 None None 237 1 7
Genomic Location (Zv9):
Chromosome 12 (position 20124267)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18906111
GRCz11 12 19027985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAGAACTGCCGCCTCCATGTGCCTCCTGTTTTGATGGTTTTATTCTGG[T/A]AAGTTAGTTATCTGCTATCTTCCTCCATTAAAATCCGCGCCGAGGTGTGA
Long Flanking Sequence:
AGATTTCCACCCCAGATGGGACTCGAACCCACAATCCCTGGCTTAGGAGGCCAGTGCCTTATCCATTAGGCCACTGGGGCTTGCGTCATGGTGTGTGTAGAATGTGTATTACAAACGGTCTTATAAACGGAATGCAAGTCGTACATTTAATCTAACTTGTTTTACCAAATTTTAAATATAATTAATATATATAAATGATTTGTTATTCAGCTATATATTTACATAAATCAGCATTCTTATTTAAGTCACACATTTGTCTAATGTTAGATTTATTTCAACGTGCAAATATCTTATTGATTTATTATAAAAATAAAAAAAACTGTATTTAAACTGACACAAATTAAAATTTTAATCCTAAAAATAATGACGTTTTCAGTAACGCTGTGCTATTATAACAATCAAAAATATTAATCGTGCTTTTATTATGAAAGAACATGACACCGGCACTTTCAAAGAACTGCCGCCTCCATGTGCCTCCTGTTTTGATGGTTTTATTCTGG[T/A]AAGTTAGTTATCTGCTATCTTCCTCCATTAAAATCCGCGCCGAGGTGTGAGGTAAATAGAAAACATTTACTTACTTTTTTAGATTTAACCAAAGTTTCTGCGCTAAATTAGCTAGTTTGAAGTCATGAATGAGATTAATGCTAGTAAGCTAACTCTCTGAGTTAGCTTAAACCGTTTGTGTATCAGCCGTAGTACCAATGATGCAATGATATTGCATTACTAGCTAGCTGTTTGAGGACTATATTGAGATTAGTAATACTGTTTAAAGTTCATCAAGCACATTTCAAATATAACACGTAGCGTTATTTCTTTGGCTGTCATTTATATCCATGTTTAGAGATAACGTTAAGCTAGCAGTGGCTATATTAATATTACAGTCTTAATAACAATGAAGTAAAATTAAGGATGTACTTTTTATATATCCTAAATAAATTCACATGATTGCGAGGTATGTTTTAGGTTTAACGAGATACGTTTTTTAAACACACTTATGTCTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31872
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078484 Essential Splice Site 100 576 4 16
ENSDART00000142253 Essential Splice Site 100 237 4 7
Genomic Location (Zv9):
Chromosome 12 (position 20122772)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18904616
GRCz11 12 19026490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTGACATGTTTACAGGCCGCCTTCGCTCTGAAATTCCACCTGCTCTGG[T/C]AAGCTTTTGTATATCCAGTTAAAAACATTTATTTCTTTTAGGGCTGCACA
Long Flanking Sequence:
GTTAATGGCTAATACAGGTCAGTTGAATTTTTGACATACTAACTTAAACATAGTTACTATAACTGCCCTTTTTCTCAGTGTTTATTTTAAATTGAATGCATTAATTAACAATTACTATTAGGACTTTATTGTAAAGTGTAAAGTGTTACCTAGTGTAATTTATAGTCCTTTTGCAATTAAATTTGTTTGAAACATTTGTTTGCTCTCAGCAGATATGTACAATTAAGCAATACAATAATTGTTTGTTTTTCTACGTTACATGAACCTTTTTGCAACTTTGGTCAATATTGTGACAATTGTGGTATAATGTACAGTGATAAAACCTTCAGGATTTAATTGCAGCAAGAAAATCTGATACCATCCTAAACCTAAATACCACTGCACAGTTTTTACTTTCACTTTTCTGCTTTTATAACTTGACATTTTTTTTCTCTCAAAGCAATGTCATTGGAGTGACATGTTTACAGGCCGCCTTCGCTCTGAAATTCCACCTGCTCTGG[T/C]AAGCTTTTGTATATCCAGTTAAAAACATTTATTTCTTTTAGGGCTGCACAATGTGATGCACAATCACATTCAGGTATAAGAAATTGTACCTTTTTTTTTTACCATAACTGATTATTTTAATGAATTATTTTTATCATTCAGTTACTGTACTTGAATATTGTTTGACTCAGGAAATAATAAAACACTTTATTTCAATTGTATTTTTCTTTCTTGATTGTATTTATGGATTGATAAGCATAAAATACTTAAAACACATGCAAAAACAGAAATACACTGTAAATAGCACAGACCACAATGAAAATGTGTCGGGGGACTTGTAAAAATGTATAGATTGTTTATTAGATTTTATAGAGGTGCTTTTCCACTGCAGTATCATCCCAATCGATCTAACATTATAAATTCTTCCCAAATAAAGATATTATGAAGTTATCTGGTGAAATTGTATTCTTAGCGCAATGTATATCGCAAGATAAGAAAATATTGCAATGTTAGATTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14788
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078484 Nonsense 366 576 11 16
ENSDART00000142253 None None 237 None 7
Genomic Location (Zv9):
Chromosome 12 (position 20111251)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18893095
GRCz11 12 19014969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGAGTAATGGGACATGCTTAATGCAGTGATGATGAAGGAGAGCCTGAT[G/T]AAGAGGACAACGACGACNNNNNNNNNNNNNNNGACGANNNNNNTGATGATGAGGAAGAAGATGAAGATGANNNNNNT
Long Flanking Sequence:
CAAAAATGAGCGCTGATGCATTTTCTATTTAAACAGCGTAGCGCAACGCCTCAAAACAACTCTTGCGCCAAGCTGAAACTACCAAAAGACTACTGCGCCACGCCTTGTGCCACACTGCGCCGGGTGTATGATAGGGCCCTAGGTCTCCTTAATAATCAAAATTAAATTTTGAATAAAAAGTTTGATTAATATTTAAATAGCTAGTTTGTGTTCAACTCATTTTGACGTTGAAGTCCTGTTATTCTGGGCTGACTGGATCTTTTCTGGGTGCTTGTTTAGGAAACTGCTTTGGAGAAGATGGCTGTGAGGCACTTAAGGAAGCAATGGAGAAAATGAACATGGAGGATCTGCTCTGCTCACTCAGGTATTTATGTGACCATTTGTAAAAAGTTGGTTTCTTGTGTGTAAGTAAATAGAGATTAAATGCATTCCTTTAATTTTTAAATACTTTGAGAGTAATGGGACATGCTTAATGCAGTGATGATGAAGGAGAGCCTGAT[G/T]AAGAGGACAACGACGACGACGATGATGATGAGGAAGAAGATGAAGATGATGATGATGATGCTGAGGAGAAAGAAGGCAATGATGCTGAGGAAAATGGTCTAAATGGAACAAAAGATGTCATTGAAGAAAAGGCAATCCTAGCATGCCTAAATAAACTGCTAAATATGTTGTGTACTTATATTTTACATGGGAAGATTGCTGATTTTTACCACTTTTCCACAGGAGGAGCCTCCCCACAGTTCTGAGCTCATGTCCTTCCTCGTCTCTCCATCAGCTGAAAAACTGATCTCACTTGGAGCCAAAAGAGTTCAGCTCATTGAACAGCAGGTACAGTGAGGATTCTTAAGGTGAATTACTACCATACTTACTACAGAATGGGTTACCAATTTTCTAACCTTCTTTAAATTTTTCCTATTTCTTTTTTATTCTTTAGGTTGATGTTACAGATGCGAATAAGGTGTCAGAAGTTTTTCTGAAGATCTCGTCAGTATATAAAGATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1862
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078484 Essential Splice Site 444 576 12 16
ENSDART00000142253 None None 237 None 7
Genomic Location (Zv9):
Chromosome 12 (position 20110923)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18892767
GRCz11 12 19014641
KASP Assay ID:
554-1853.1 (used for ordering genotyping assays)
KASP Sequence:
AAAAACTGATCTCACTTGGAGCCAAAAGAGTTCAGCTCATTGAACAGCAG[G/A]TACAGTGAGGATTCTTAAGGTGRATTACTACCATAMTTACTACAGAATGG
Long Flanking Sequence:
GAAAATGAACATGGAGGATCTGCTCTGCTCACTCAGGTATTTATGTGACCATTTGTAAAAAGTTGGTTTCTTGTGTGTAAGTAAATAGAGATTAAATGCATTCCTTTAATTTTTAAATACTTTGAGAGTAATGGGACATGCTTAATGCAGTGATGATGAAGGAGAGCCTGATGAAGAGGACAACGACGACGACGATGATGATGAGGAAGAAGATGAAGATGATGATGATGATGCTGAGGAGAAAGAAGGCAATGATGCTGAGGAAAATGGTCTAAATGGAACAAAAGATGTCATTGAAGAAAAGGCAATCCTAGCATGCCTAAATAAACTGCTAAATATGTTGTGTACTTATATTTTACATGGGAAGATTGCTGATTTTTACCACTTTTCCACAGGAGGAGCCTCCCCACAGTTCTGAGCTCATGTCCTTCCTCGTCTCTCCATCAGCTGAAAAACTGATCTCACTTGGAGCCAAAAGAGTTCAGCTCATTGAACAGCAG[G/A]TACAGTGAGGATTCTTAAGGTGAATTACTACCATACTTACTACAGAATGGGTTACCAATTTTCTAACCTTCTTTAAATTTTTCCTATTTCTTTTTTATTCTTTAGGTTGATGTTACAGATGCGAATAAGGTGTCAGAAGTTTTTCTGAAGATCTCGTCAGTATATAAAGATGAACCAGAAGTAAAGCAAGCTGTTTTTGAGACCACTGGTATGAGCAGCATGCTTATTTTCCTTAAAGTAAACACCTAAAACAAGTCTGTTATGCTGTTTTTACAAGATGTAGTATAAGTCTCAGGGTTCTCCACAATATGTCTGACACATTTCTGCTGGAAATGCCTCTCAAATACCTGTTTATTATATTATGATGTAATGTAAATAGGAGGTGTTGCCAAGAAATACTTTATCATGCTTTACTGTTATTTTAACAACATTTCTGTCTAAAGAGGTTCTGCCCATAGTTTACTCAGAAATGAAAATTCAATCAGTTTACTCTGCCTTAA
Associated Phenotype:
Not determined