Busch Lab

ZMP

LOC568267

Ensembl ID:
ENSDARG00000056050
Human Orthologue:
KCTD17
Human Description:
potassium channel tetramerisation domain containing 17 [Source:HGNC Symbol;Acc:25705]
Mouse Orthologue:
Kctd17
Mouse Description:
potassium channel tetramerisation domain containing 17 Gene [Source:MGI Symbol;Acc:MGI:1920094]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42010 Nonsense Mutation detected in F1 DNA Not yet available
sa42011 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42010
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078476 Nonsense 138 214 4 6
Genomic Location (Zv9):
Chromosome 12 (position 20152166)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18934010
GRCz11 12 19055884
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGTGTTTCTCATACAGCAGGTACCGCCGAAGCATGTGTATCGGGTGT[T/A]GCAGTGTCAGGAAGAGGAACTGACCCAGATGGTGTCCACCATGTCGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42011
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078476 Essential Splice Site 160 214 4 6
Genomic Location (Zv9):
Chromosome 12 (position 20152234)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18934078
GRCz11 12 19055952
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGACCCAGATGGTGTCCACCATGTCGGACGGCTGGAAGTTTGAGCAG[G/A]TCAGCGTGCGCGCCTGCCGAAAACCCCGCCCCGGACTGCTCTGGACTGTG
Associated Phenotype:
Not determined