Busch Lab

ZMP

hoxb9a

Ensembl ID:
ENSDARG00000056023
ZFIN ID:
ZDB-GENE-990415-109
Description:
Homeobox protein Hox-B9a [Source:UniProtKB/Swiss-Prot;Acc:Q9PWM2]
Human Orthologue:
HOXB9
Human Description:
homeobox B9 [Source:HGNC Symbol;Acc:5120]
Mouse Orthologue:
Hoxb9
Mouse Description:
homeobox B9 Gene [Source:MGI Symbol;Acc:MGI:96190]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14877 Nonsense Available for shipment Available now
sa17045 Essential Splice Site, Missense Available for shipment Available now
sa31325 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14877
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Nonsense 135 253 1 4
ENSDART00000023674 Nonsense 135 249 1 2
Genomic Location (Zv9):
Chromosome 3 (position 23969146)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23547357
GRCz11 3 23677905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCTGGGACATCTCGGGGAACCGCCAAAACTCGTTGGGCAGCACGAGTA[T/G]ATCTTGGAGTCCTCCACAGCACGGGAGATAAATTCTGGTCACAGCGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17045
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Missense 171 253 2 4
ENSDART00000023674 Essential Splice Site 172 249 None 2
Genomic Location (Zv9):
Chromosome 3 (position 23969257)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23547468
GRCz11 3 23678016
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATAAGRASATATGCGAAGGCAGCGAAGACAAAGAGGGACCGGATCAAAG[T/A]AAGTTATAAACCTAGGAAGTGAACACTCTGTAAAGCGTTTAATGCTGTCR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31325
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Nonsense 215 253 4 4
ENSDART00000023674 Nonsense 211 249 2 2
Genomic Location (Zv9):
Chromosome 3 (position 23971881)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23550092
GRCz11 3 23680640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAGACCTTGGAACTAGAGAAGGAATTTCTGTTCAATATGTACCTCACC[C/T]GAGACCGAAGACACGAGGTTGCTCGTCTACTGAACTTGACGGAGCGACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5198
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006479 Nonsense 250 253 4 4
ENSDART00000023674 Nonsense 246 249 2 2
Genomic Location (Zv9):
Chromosome 3 (position 23971986)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23550197
GRCz11 3 23680745
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATATGGTTCCAAAACAGAAGGATGAAAATGAAGAAAATGAATAAGGAC[C/T]AGCCCAAAGAATAACGCAGACTGGTACTAGGCGTTCGAGCCATTTACAAG
Associated Phenotype:
Not determined