Busch Lab

ZMP

TTBK1 (1 of 2)

Ensembl ID:
ENSDARG00000056019
Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Human Orthologue:
TTBK1
Human Description:
tau tubulin kinase 1 [Source:HGNC Symbol;Acc:19140]
Mouse Orthologue:
Ttbk1
Mouse Description:
tau tubulin kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2147036]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa1130 Nonsense F2 line generated Not yet available
sa21939 Nonsense Available for shipment Available now
sa27808 Nonsense Mutation detected in F1 DNA Not yet available
sa7291 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27807
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Essential Splice Site 110 1162 3 20
Genomic Location (Zv9):
Chromosome 11 (position 31554887)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30432249
GRCz11 11 30679433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGGCTGTGGGCGAAACGATAAATTCAACTATGTCGTCATGCAGCTGCAG[G/T]TAAACAATACAGAAGCTACTATACTATAACAATACTATAACATAACATCA
Long Flanking Sequence:
AGTAGTCATATTTTACATGAACTCTTCTTATAGTTTACATTTTTAGTTTATTTTACATTTTTATGTATTTTTTTGTTTTTGCTTTTATCGTTTCCATTTAGAGAATATTTCTGTTTAATTTGGATTTTAGTCAATTTAGAGCTCTAGTGTAATTTAGTTCAGTTAGTCAACAACAGAAAATTATATATTTTATTTATTGTTATTAATTTATATTTATATTTAATATATATTTTATTTATATATAATTAATCATTTATTGTTGGTTGTATTTATATCAGCAAATAATTTTACATAGGTAACAGCAACACTACCTGACACATTCTGGTGTATTTGAGTCAATATAGTTATTGGCTTTTTAAATCAATCAGGATTGCTATCCTTATATTTTCATAAATGACCCACGTTAATACTATTTCCTTCTTTCAGGTAAAAACCACGTATGTAAGTTCATAGGCTGTGGGCGAAACGATAAATTCAACTATGTCGTCATGCAGCTGCAG[G/T]TAAACAATACAGAAGCTACTATACTATAACAATACTATAACATAACATCATACTATACCGTAACAATACTAAATGTTATTTAAATGGACACATCAGCTCATGCAGAGCAACGTAAACAAATAATCTTTAAAACAGAACCATGCACAACATTTCATAGTACAGTAGATCTTCATCACACGCTATTTTTGTGACTATTTTTTGAGGAATGTGTGGGGATTCACTTACACTTTATTATCATTCTCAGGGCAGAAACCTGGCAGATCTCAGGCGAAGTCAGCCTCGCGGCACCTTTACCATGAGCACAACCCTCCGCTTGGGAAAACAGATCCTCGAATCCATAGAAGCCATTCACTCCGTTGGCTTTCTCCATCGAGACATCAAACCGGTAATGTCTAATAGCTGTAATGCTTGAAATTGTAATACATGGAGAATAATAACATGTCAGTGTCATTTGGTTTTGAGAAATGGTTTCATTTATTAATGATGTATGGATTTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1130
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Nonsense 281 1162 8 20
Genomic Location (Zv9):
Chromosome 11 (position 31563284)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30440646
GRCz11 11 30687830
KASP Assay ID:
554-1041.1 (used for ordering genotyping assays)
KASP Sequence:
CCGTCAGAGTTTAATGTCTTCCTGGAGCATGTTTTAGCCCTTGACTACTA[T/A]ACCAAACCAGACTATCAGGTACCTACAAACTACCTACACATTTAGTATTC
Long Flanking Sequence:
TAAATATCGGCTATCTGTACTTAATCATTTGCCAAGATGTACTTAGACATTTACAATTTGATGAAATGAATGAGAAAATCAAGTCTGTTTTGAACAATTGCCAAGTGGTTTGGAGGTTTGTCCATGTTGTTTTGAGAATGTAATTCCTGTATTAAGAAATGAGCCAAACCAATAGAGAAAAACTGCAAGTAAAGATCATGTTCCATACAGATATTTGTACATTTCCTATTGTAATTATATTGAACTCAGTTACTAATTTAGCAATTTGGATTGCTAAGCATTTTGTTTTAAACATCTTTAAGGGTGATTTTTCTCAGTATTTAGATTTTTCAACTTTCAGATTGTGTAAAGACAACATTGTTGAAATCTTCTGTTGTTATCTGCATCATTCAGGAGCAAGTGGGTCAGATTAAGGAGCGCTACGATCATAGGATGCTTCTTAAACACATGCCGTCAGAGTTTAATGTCTTCCTGGAGCATGTTTTAGCCCTTGACTACTA[T/A]ACCAAACCAGACTATCAGGTACCTACAAACTACCTACACATTTAGTATTCATTGTACCAGTTGTATTATTGTTGTATTACAATGTATGAATTAGTACCAGACAGACATGAATAACATTATTACAGTAAAAGTTTCTTTTTTTCTTGTTAAATAAGTTTTTATTAAAGCCAAAGATTTAGGAAAAAGAATTCTCTGTTTTACATATTTGTCCACATATTACATTAGCAAAAAAAGAAAATTAAATAAATAAGTACAATTAAAAAAGATTATAATAACAAATAAAAACAGCGAAAAATTCTAAAAGGTTTTTTAAAAATATAATTTAAATATAATGTGAAAAATAAAAACAGGTGATTTTTCTAAGGTATGTTTTCTGTGTCAGCTCCTGATGTCAGTGTTCGAGAACAGCATGAAGGAACGCATCATCACTGAAAACGAGCCCTATGATTGGGAGAAAAGTGGGACGGAGACTATTATCTCTGCTACCACACCGACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21939
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Nonsense 538 1162 12 20
Genomic Location (Zv9):
Chromosome 11 (position 31581763)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30459125
GRCz11 11 30706309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGACTTCGACAGCAAAGAGTGGGTGATCATAGACAAGGAAATGGAGCTC[A/T]GAGACTTCCACCACCTTCCAGGAGCCGAACCTACCACTTCCGGCACGACG
Long Flanking Sequence:
ATTAAACTCGGAAAAAAATGTCATCGGTAGTTCAGAGAATGAAACAAAAATTACAATTCAACCCAACACATCACAATATATATTTATAATATATATATAATAATAATATTCTGTTTAAATGACCTCTTCGTTACTTTAGTAGAATTGTCCTTTTAGAATTAGTAGAATTAGTAGAATTTTAGATTAGTAGAATTCTTTTCTACAGTGTGTGCTTTGTGTCATGTATAATTGACCTAAATAACCAACAATAAACAATTTCTTCCCTAAATGTCTCTTTTCTCAGCTCTCGAATGGACATTCTGGGTTCTCCATCTCGTCACGTTTACTCCTCTCAGCCCGCTCAGATGCTCTCGGTGGACGGTTGCAGAGGCCGTAATGAAGCCTCTGCATCGGTGGACCAGGAAGCCCACAGCAATGCCTTCATCCGCTCAGTCCCGCTCGCAGAAGAAGAGGACTTCGACAGCAAAGAGTGGGTGATCATAGACAAGGAAATGGAGCTC[A/T]GAGACTTCCACCACCTTCCAGGAGCCGAACCTACCACTTCCGGCACGACGGATGAGGAGCCGGAGGAATTACGCCCTCTGGAGGAAGGAGATGATCGGAGGAGACACAGAGGGAACGATCCATCCGTCAGAACCAAAACGTCCCATGGAGAACGGACTACACGAGGGATGCTACCACTGACGGAGGAAGAGACATCCAGGAGGAGTGGGAAAGGCCAGTCCACGTCAATGGAGAGCCCTGCGCAGTCACCCTGTCACTCGCTGCCCTCCGGACGGCCCCGGCGGAGAGATGCAGATAACAACGGACCTCAGAGACAGGTAAGATTATCCTTTCTAGCACGCTCTGACATGCTAATGCTGAAGATGGAGTGGGTTATGGTCAAAAAAGGTCTGATGGTGGTAAAGAGACCACGAGGTCCAGGTAAAAGAGCAATTTGATAACTGATGTTTTTTTTTTTCGCAGAGGTCTTTTAGTGCGGTTGTTGTGTTTATAAGCTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27808
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Nonsense 641 1162 12 20
Genomic Location (Zv9):
Chromosome 11 (position 31582072)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30459434
GRCz11 11 30706618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTGCCCTCCGGACGGCCCCGGCGGAGAGATGCAGATAACAACGGACCT[C/T]AGAGACAGGTAAGATTATCCTTTCTAGCACGCTCTGACATGCTAATGCTG
Long Flanking Sequence:
CATCTCGTCACGTTTACTCCTCTCAGCCCGCTCAGATGCTCTCGGTGGACGGTTGCAGAGGCCGTAATGAAGCCTCTGCATCGGTGGACCAGGAAGCCCACAGCAATGCCTTCATCCGCTCAGTCCCGCTCGCAGAAGAAGAGGACTTCGACAGCAAAGAGTGGGTGATCATAGACAAGGAAATGGAGCTCAGAGACTTCCACCACCTTCCAGGAGCCGAACCTACCACTTCCGGCACGACGGATGAGGAGCCGGAGGAATTACGCCCTCTGGAGGAAGGAGATGATCGGAGGAGACACAGAGGGAACGATCCATCCGTCAGAACCAAAACGTCCCATGGAGAACGGACTACACGAGGGATGCTACCACTGACGGAGGAAGAGACATCCAGGAGGAGTGGGAAAGGCCAGTCCACGTCAATGGAGAGCCCTGCGCAGTCACCCTGTCACTCGCTGCCCTCCGGACGGCCCCGGCGGAGAGATGCAGATAACAACGGACCT[C/T]AGAGACAGGTAAGATTATCCTTTCTAGCACGCTCTGACATGCTAATGCTGAAGATGGAGTGGGTTATGGTCAAAAAAGGTCTGATGGTGGTAAAGAGACCACGAGGTCCAGGTAAAAGAGCAATTTGATAACTGATGTTTTTTTTTTTCGCAGAGGTCTTTTAGTGCGGTTGTTGTGTTTATAAGCTTGTGAGATGTCAAAAATGATAAATGGTCTGGATAAGAATAATGTTAATTCAATAAATTAAATCAGGAGAAGGATGTTTATTGTTCATGAATCAGAACTTATCAACTGAAGACTGGATTTATCTGGTAATAATGACATTAAAGATGAGGGACCCTTTTCACAAGACTGTTCTGACGTGTTTAAAGGTCATCAGCATCTCAAATTCTTGGACATTTTTAATATTTAGATTTATATTTATTTATGTATGTGTTATATTATATTTACATCAAATTGCAAAAAAAAAAAAATTACCACTTGTGCGAGGTGTTTGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7291
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Essential Splice Site 658 1162 15 20
Genomic Location (Zv9):
Chromosome 11 (position 31585125)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30462487
GRCz11 11 30709671
KASP Assay ID:
554-5367.1 (used for ordering genotyping assays)
KASP Sequence:
GAGCGATAAAACAATGAGGTCSTCTGTAGCACATCCTGGTGTTGTCTTTA[A/C]TAGTGTTGTCCCAATACTGAGCTTTCAAGCGGAACTKTTTAAGCGGCGCT
Long Flanking Sequence:
ATTTTTGGGTGAACTGTCCCTTTAACTTTTTGAAAGCGAATTCTGTTGTCACAACTATATACACTATAAAAATGCTGTATTCCACACAATTCACTTATTTTACGCTGCCGCCATTTTAAAACATGAAAGCGAGGCTGCGGTGGGAAGAAACCCAGAAGTATAGGATTAGCACTGTAAACATTGCAACAACATGCTGTGGACTACAAACTTCTAGCTGTTGCCGCTATTTCAAATGCCGCTTTTTTTTTTTCAAAATGCAGATATGTTGTAAACATGACTTTATTATCATTCAGTTCAGTTTAATTCAAACAATTAAAAGCAGATTAGGCATCTAACAACATCACAATCTCTTTTAAGGGTAATATGCTTAAATGTCCTCCTAGGTTTCAGTTCATGGCAGCAGGTAAACCCCATGGAGACGCTTTTTTGCTTCAGCCTATGTAGCCCAGTGAGCGATAAAACAATGAGGTCGTCTGTAGCACATCCTGGTGTTGTCTTTA[A/C]TAGTGTTGTCCCAATACTGAGCTTTCAAGCGGAACTTTTTAAGCGGCGCTGAGCGCATTCATAGACACTGCTGGTTTGCCGTAGTATTCACCAGTGCTCAACAGAAATTACTGTAATTGGCTGTGAAGAACATCAAACACAGATGAGCTGCTGATAAATCGACTGATCTTCACGGCTTTACAACGATCCAATGTCTGTCTATCTGTGTTTGCAATCTGTGAAGAGCAGTATACTGATGACCTTCACGGCCAATCACAGCCATTTCTGTTGAGCACTGGTGAATACTAAGGCAAATCAGCAGTGTTTATGAATGCACTCAGCGTATCAACAGTGCCTTTAATGTTAGCGGGAAATGGGACGTTTTATTTTTTTATTTCAGTACCAAAATTTTGTGTTGTGACAAGTTAATCAACTCATTCTTTTACTATATTAAACTTAAGTTTGATAAAAGGCATCTAAAACGTGTGTTTGTGAAAGAAAACGTTACCTAACTATTGCCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19008
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023981 Nonsense 1128 1162 20 20
Genomic Location (Zv9):
Chromosome 11 (position 31598249)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30475611
GRCz11 11 30722795
KASP Assay ID:
2260-4467.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGGAGATGAGCCCAAGAGACCTTCAGAGACTCTTTCTACTACAGGCT[C/A]GGAAGAAGATGTTCTTGAATCTGATGATTCCCTAAACAAGCTCAAGAAGG
Long Flanking Sequence:
AGAGCCAGGAGGAGGTGCAGCTTGTGTCCAGTCTGAAGTCATCTCTCAGATTCTTACAGAGGAATCTCAGGTACCTAATGTCCTAGATGGGTCTTTGCCAAATGAATCAACTGTAAAGCAAGAAAATCCTACGGATCCTCTATGTGTACAGTCTATGGAACCCATCATTCAAGATTCAACAATTGACTCCAATCAGGACGAAAAACCAAAAGAAGAAATTCAAGAGGGGAGCACAGTACCTGATATTGTTTCTAAACCTCCAAGGCCAAGAAGCAGAAGTCGGATTCCTATTCTAGTCCCGGAAGAGGAGCCAGGATCTGAGAAATCCCTGTCCACCAAAGAACGAATGCGTAGAAGAGTCATGCAGCAAGACCTGGCCCGTCAAGTTGTGGAAAGACATCGTCAGGGTCGCTGGATAAGACTGAATTCCAGGACATCATCTTCGTTATCTTCTGGAGATGAGCCCAAGAGACCTTCAGAGACTCTTTCTACTACAGGCT[C/A]GGAAGAAGATGTTCTTGAATCTGATGATTCCCTAAACAAGCTCAAGAAGGAGGCTGAGGAAAAGCACCAAACTGGCTGGCACAGCAGGATCCCTCGACCAGTCACCCCAATAAGGAAGCCTTCGACTAAACTAGTTGTTGCACCTCCTTTGAGCCAACCTGAAGCTGCAAAATTAGAACAAAAAGCAAGCAATGGGTAAGTCTACCTCATTATAATGAAATGTTACATATTTATTAAGAACATGCTTGAAAGACAAGGTTGTGCACTATTTAGAATAAAATTTAAAGCATGTGTATTCCTCTTCTTGCTGTTCCAGTTGAAATTACATTTCAATTTTTCAAATAAGATGTTGCTAATTCAATCGAATTCACCCCTATGAAATTAAAGGGAGCCGTGAACCAAATTGAATTCCAAGTAGGTCTAGGCAGGTGTATGATAGAGCATGTCTAGTGTAGGTTTTGTTGGTAGACCAGTTGCTGGTCCCATTCTGATGAACAGTG
Associated Phenotype:
Not determined