Busch Lab

ZMP

si:ch211-165b19.5

Ensembl ID:
ENSDARG00000055986
ZFIN ID:
ZDB-GENE-070912-133
Description:
Novel protein similar to vertebrate granzyme family [Source:UniProtKB/TrEMBL;Acc:A8WIQ3]
Human Orthologues:
AZU1, ELANE, PRSSL1, PRTN3
Human Descriptions:
azurocidin 1 [Source:HGNC Symbol;Acc:913]
elastase, neutrophil expressed [Source:HGNC Symbol;Acc:3309]
protease, serine-like 1 [Source:HGNC Symbol;Acc:31397]
proteinase 3 [Source:HGNC Symbol;Acc:9495]
Mouse Orthologues:
Elane, Prssl1, Prtn3
Mouse Descriptions:
elastase, neutrophil expressed Gene [Source:MGI Symbol;Acc:MGI:2679229]
protease, serine-like 1 Gene [Source:MGI Symbol;Acc:MGI:1920356]
proteinase 3 Gene [Source:MGI Symbol;Acc:MGI:893580]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21518 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078384 Nonsense 47 247 2 5
ENSDART00000141482 Nonsense 28 222 1 4
Genomic Location (Zv9):
Chromosome 9 (position 33693033)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32848979
GRCz11 9 32659725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGGCTAAACATCATTCCAGACCATACATGGCATCTCTGCAGAAAAAA[C/T]GAAATCATGTTTGTGGAGGGATGCTGATAAAAGAAGATTATGTGTTGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5550
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078384 Nonsense 98 247 3 5
ENSDART00000141482 Nonsense 73 222 2 4
Genomic Location (Zv9):
Chromosome 9 (position 33691636)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32847582
GRCz11 9 32658328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCTCACAAYATCAGTCAGAAAGAGAACAGTCAGCAGATAATTCAAGTT[G/T]AAAAATACATAAAACATCGCAAGTTTGATATTATGTTACTAAAGGTATTT
Associated Phenotype:
Not determined