Busch Lab

ZMP

si:ch1073-416j23.1

Ensembl ID:
ENSDARG00000055934
ZFIN ID:
ZDB-GENE-100922-35
Description:
LOC553480 protein [Source:UniProtKB/TrEMBL;Acc:Q501Z7]
Human Orthologue:
RACGAP1
Human Description:
Rac GTPase activating protein 1 [Source:HGNC Symbol;Acc:9804]
Mouse Orthologue:
Racgap1
Mouse Description:
Rac GTPase-activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1349423]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41362 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27353
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078348 Essential Splice Site 35 650 1 16
ENSDART00000134911 Essential Splice Site 27 548 1 13
Genomic Location (Zv9):
Chromosome 9 (position 11029820)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10833487
GRCz11 9 10804690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTATGCTTGCAAAGGCTTGCTATTGAAGAAGCTTCTAACTCTGAGCTCG[G/T]TAAGATACCATAGGTCAATGCTTTGCTTATTTACATTTTTGATTGTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41362
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078348 Nonsense 274 650 8 16
ENSDART00000134911 Nonsense 266 548 8 13
Genomic Location (Zv9):
Chromosome 9 (position 11018655)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10822322
GRCz11 9 10793525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGACACATTCTAACCTTCCCAAACTAAGCGGAGTCCTGCGTGCAGAA[C/T]AAACATCTGTGTGGGCTCACAGTGAAGTCATCCAGGCTGAGACGATGGTT
Associated Phenotype:
Not determined