Busch Lab

ZMP

si:ch73-38p6.1

Ensembl ID:
ENSDARG00000055900
ZFIN ID:
ZDB-GENE-030925-30
Description:
zinc finger SWIM domain-containing protein 5 [Source:RefSeq peptide;Acc:NP_001138291]
Human Orthologue:
ZSWIM5
Human Description:
zinc finger, SWIM-type containing 5 [Source:HGNC Symbol;Acc:29299]
Mouse Orthologue:
Zswim5
Mouse Description:
zinc finger, SWIM domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1921714]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14813 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2030
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078305 Splice Site, Nonsense 553 1151 7 14
Genomic Location (Zv9):
Chromosome 2 (position 27680721)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27876917
GRCz11 2 27532551
KASP Assay ID:
554-2566.1 (used for ordering genotyping assays)
KASP Sequence:
TCCGACTCCAACAGCAGCGGCARTTAGACATATACAAGCATCAGAAGAAA[G/T]GTTTGCATTGCAATACAACAAACCAAATGCTGACAAACGATTCATTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14813
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078305 Essential Splice Site 552 1151 7 14
Genomic Location (Zv9):
Chromosome 2 (position 27680722)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27876918
GRCz11 2 27532552
KASP Assay ID:
2259-2093.1 (used for ordering genotyping assays)
KASP Sequence:
CCGACTCCAACAGCAGCGGCARTTAGACATATACAAGCATCAGAAGAAAK[G/A]TTTGCAYTGCAATACAAMAAACCAAAWGCTGACAAACGATTCATTACATG
Associated Phenotype:
Not determined