Busch Lab

ZMP

slc26a6

Ensembl ID:
ENSDARG00000055835
ZFIN ID:
ZDB-GENE-081105-83
Description:
Novel protein similar to solute carrier family 26, member 5 (Slc26a5) [Source:UniProtKB/TrEMBL;Acc:A
Human Orthologue:
SLC26A6
Human Description:
solute carrier family 26, member 6 [Source:HGNC Symbol;Acc:14472]
Mouse Orthologue:
Slc26a6
Mouse Description:
solute carrier family 26, member 6 Gene [Source:MGI Symbol;Acc:MGI:2159728]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa34418 Missense, Nonsense Mutation detected in F1 DNA Not yet available
sa41223 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10168 Nonsense Available for shipment Available now
sa18277 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34418
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045602 None None 733 None 21
ENSDART00000078228 Missense 285 360 7 8
ENSDART00000113763 None None 292 None 10
ENSDART00000138882 None None 598 None 15
ENSDART00000140112 None None 141 None 3
ENSDART00000142031 Nonsense 51 313 2 10
ENSDART00000147411 Nonsense 51 224 2 7

The following transcripts of ENSDARG00000055835 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 27114616)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26242534
GRCz11 8 26261673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGACTGTATCTTTCCAACACTAATATGGTTTCTTAATGTTTCTAGATTA[T/A]CTTTGCCACTCTGTCATCAGTGCAGTTGGATTTGTCGGGTCAGTATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41223
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045602 None None 733 None 21
ENSDART00000078228 None None 360 None 8
ENSDART00000113763 Essential Splice Site 61 292 3 10
ENSDART00000138882 None None 598 None 15
ENSDART00000140112 None None 141 None 3
ENSDART00000142031 Essential Splice Site 178 313 6 10
ENSDART00000147411 Essential Splice Site 178 224 6 7

The following transcripts of ENSDARG00000055835 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 27116544)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26244462
GRCz11 8 26263601
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTATTTATTATATAAAGCATGCTTTTATGGTGACTTTTTGTTTGTTCC[A/T]GACAGTTTTGGCTGTCATTATTTTAGTGAATCTCCAAGGGGTTTTTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10168
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045602 Nonsense 130 733 4 21
ENSDART00000078228 None None 360 None 8
ENSDART00000113763 None None 292 None 10
ENSDART00000138882 Nonsense 127 598 4 15
ENSDART00000140112 None None 141 None 3
ENSDART00000142031 None None 313 None 10
ENSDART00000147411 None None 224 None 7

The following transcripts of ENSDARG00000055835 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 27124337)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26252255
GRCz11 8 26271394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NAAACTGAGCAGCATTTKCTCATATTCTCATATCTGTCTCCAGGTACATA[T/A]GCAGTTATGAGTGTTATGATTGGCAGTGTGACAGAGCGTTTGGCTCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18277
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045602 Nonsense 245 733 6 21
ENSDART00000078228 None None 360 None 8
ENSDART00000113763 None None 292 None 10
ENSDART00000138882 Nonsense 242 598 6 15
ENSDART00000140112 None None 141 None 3
ENSDART00000142031 None None 313 None 10
ENSDART00000147411 None None 224 None 7

The following transcripts of ENSDARG00000055835 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 27126067)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26253985
GRCz11 8 26273124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
WTGAAGTATAAAGCTTTTCTTTATTTTCTTTCTCTCTTCAGACAGTCATC[G/T]AGATTWGTGCATTGCTYGGAAAGACCAACATYGGTACACTGGTTGTCAGC
Associated Phenotype:
Not determined