Busch Lab

ZMP

celsr3

Ensembl ID:
ENSDARG00000055825
ZFIN ID:
ZDB-GENE-070122-3
Description:
Cadherin, EGF LAG seven-pass G-type receptor 3 [Source:UniProtKB/TrEMBL;Acc:A9C3S7]
Human Orthologue:
CELSR3
Human Description:
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Celsr3
Mouse Description:
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa34415 Nonsense Available for shipment Available now
sa38693 Nonsense Mutation detected in F1 DNA Not yet available
sa2445 Nonsense F2 line generated Not yet available
sa34416 Nonsense Mutation detected in F1 DNA Not yet available
sa9305 Nonsense Mutation detected in F1 DNA Not yet available
sa11108 Essential Splice Site Available for shipment Available now
sa7333 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available
sa34417 Nonsense Mutation detected in F1 DNA Not yet available
sa10576 Essential Splice Site Available for shipment Available now
sa38694 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21306 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34415
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 127 2916 1 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 157 2065 1 21
Genomic Location (Zv9):
Chromosome 8 (position 26978629)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26106547
GRCz11 8 26125686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCTGACCGAAATGATCACTCACCTGTGTTTGAGCAAACAGAGTATCGT[G/T]AGACCATTCGGGAGAATGTAGAAGAGGGATATCCGATACTACAGCTGCGA
Long Flanking Sequence:
AAAGCGAAGTTGGGGTGGGTAATCAGTACAGCGAAAAACAAAAATATAAAGATAGTGATGAAGTGCTCAGGGAAGAGGGACAGGAATACAGTGAAGAGCAGACAGGTATCCCTTCTGCCGGGCGCTCCCGTAGAGCTGCTAATCGACAACCCCAATTCCCCCAGTATAACTACCAGGTTCAGGTTGCTGAGAACCAGCCTCCTGGTACCTCAGTTATAGCTATGACAGCTGAGGACCATGATGCTGGTGAGGCAGGCAGACTCAGTTACAGCATGGCCCCTTTAATGAACAGCAGGTCCATGGATTATTTTCAAATCGACCCAATTACTGGCCTTCTCACCACCACACACATTCTGGATCGTGAACACATGGACCTGCACTACTTTAGAGTTACTGCCGCAGACCACGGCTCTCCACATCTTTCAGGGACGACTATGGTGACCATCACTGTGGCTGACCGAAATGATCACTCACCTGTGTTTGAGCAAACAGAGTATCGT[G/T]AGACCATTCGGGAGAATGTAGAAGAGGGATATCCGATACTACAGCTGCGAGCAACAGATCTTGACTCAACAGCAAATGCCAACATACGCTACAGATTCGTCGGAGAAAGTGCAGCTGTCGCACGCTCTGCTTTTGAAATTGATCCACGGTCAGGCTTGATCACAACACGAGGTATTGTTGATAGAGAAACAAACGAGCGCTATACATTGTTGGTGGAAGCCAGCGACCAGGGGAGAGAGCCAGGGCCACGGTCGGCTACTGTTAGCGTCCATATCACTGTGCTGGATGAGAATGACAACGTTCCACAGTTCAGTCAAAAACGATATGTAGTAGCAGTTCGAGAAGATGTCCGACCACATTCCGAAATACTTAGAATCAGCGCTACGGACCAGGATAAAGATGGCAATGCTGCTGTGCACTACAACATAATCAGTGGGAACAGCCGTGGACAGTTTGCGATTGACAGTGTTACTGGAGAAATCCAGGTGGTTGCGCCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38693
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 183 2916 1 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 213 2065 1 21
Genomic Location (Zv9):
Chromosome 8 (position 26978797)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26106715
GRCz11 8 26125854
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCACGCTCTGCTTTTGAAATTGATCCACGGTCAGGCTTGATCACAACA[C/T]GAGGTATTGTTGATAGAGAAACAAACGAGCGCTATACATTGTTGGTGGAA
Long Flanking Sequence:
ACTACCAGGTTCAGGTTGCTGAGAACCAGCCTCCTGGTACCTCAGTTATAGCTATGACAGCTGAGGACCATGATGCTGGTGAGGCAGGCAGACTCAGTTACAGCATGGCCCCTTTAATGAACAGCAGGTCCATGGATTATTTTCAAATCGACCCAATTACTGGCCTTCTCACCACCACACACATTCTGGATCGTGAACACATGGACCTGCACTACTTTAGAGTTACTGCCGCAGACCACGGCTCTCCACATCTTTCAGGGACGACTATGGTGACCATCACTGTGGCTGACCGAAATGATCACTCACCTGTGTTTGAGCAAACAGAGTATCGTGAGACCATTCGGGAGAATGTAGAAGAGGGATATCCGATACTACAGCTGCGAGCAACAGATCTTGACTCAACAGCAAATGCCAACATACGCTACAGATTCGTCGGAGAAAGTGCAGCTGTCGCACGCTCTGCTTTTGAAATTGATCCACGGTCAGGCTTGATCACAACA[C/T]GAGGTATTGTTGATAGAGAAACAAACGAGCGCTATACATTGTTGGTGGAAGCCAGCGACCAGGGGAGAGAGCCAGGGCCACGGTCGGCTACTGTTAGCGTCCATATCACTGTGCTGGATGAGAATGACAACGTTCCACAGTTCAGTCAAAAACGATATGTAGTAGCAGTTCGAGAAGATGTCCGACCACATTCCGAAATACTTAGAATCAGCGCTACGGACCAGGATAAAGATGGCAATGCTGCTGTGCACTACAACATAATCAGTGGGAACAGCCGTGGACAGTTTGCGATTGACAGTGTTACTGGAGAAATCCAGGTGGTTGCGCCGCTTGACTTTGAGACAGAGCGAGAATATACACTACGGCTGCGGGCTCAGGACAATGGCCGACCACCTCTGTCTAACAACACTGGAATTGTTAGTGTGCAGGTCACCGATGTCAATGATAATCCACCAATCTTTGTATCCACGCCATTTCAGGCTACGGTGCTAGAGAGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2445
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 718 2916 1 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 748 2065 1 21
Genomic Location (Zv9):
Chromosome 8 (position 26980404)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26108322
GRCz11 8 26127461
KASP Assay ID:
554-3086.1 (used for ordering genotyping assays)
KASP Sequence:
GGAATAGTCCGAACTGTCCGGAGACTTGACCGTGAAAGCGTTCCCTTCTA[C/A]GAGCTGACAGCATTTGCTGTGGATCGTGGCGTTCCACCTCAGCGTACACC
Long Flanking Sequence:
GTAAATGAGGACAGGCCTCCTGGCAGCACTGTGGTAGTCATAAGCGCAACAGATGATGATGTTGGAGAAAACGCGCGCATCACTTACTACCTAGAGGATAATATTCCACAGTTCCGAATAGATCCTGCGTCTGGAGCGATCACACTTCAAGCAGAGCTAGACTATGAGGACCAGATGACTTACACACTGGCCATCACTGCTCGTGACAATGGAATCCCCCAGAAATCGGACACCACATATGTGGAGGTCAATGTTAATGATGTGAATGACAATGCACCTCAGTTCCTGAGCCCCAGGTATCAGGGTGGAGTCAGTGAGGATGCTCCACCTTTCACAAGTGTTCTGCAGATCTCTGCTACTGACCGTGATGCTCATGCCAATGGCCGTGTCCAGTATACATTTCAGAATGGAGAGGATGGAGATGGGGATTTTACAATAGAACCAACCTCTGGAATAGTCCGAACTGTCCGGAGACTTGACCGTGAAAGCGTTCCCTTCTA[C/A]GAGCTGACAGCATTTGCTGTGGATCGTGGCGTTCCACCTCAGCGTACACCTGTACACATTCAAGTCAGTGTCATGGATGTCAATGACAATGCTCCAGTGTTCCCAGCCGATGACTTTGAAGTTCTAGTAAAGGAGAATAGTGCTGTTGGGTCAGTCGTAGCTCAAATCACAGCGACTGATCCAGATGAGGGCCCAAATGCTCAGATTATGTATCAGATAGTGGAAGGCAATATTCCAGAAATCTTCCAGATGGACATTTTTTCAGGAGAACTCACTTCCTTAATTGACCTTGACTATGAGACGCGTAATGAATATGTAATCGTGGTCCAGGCCACGTCAGCCCCACTAGTCAGTCGTGCCACAGTGCGTATCCGACTGGTTGACCAGAATGATAATGGGCCCCAAATGCAAGACTTTCAAATCATCTTTAACAACTTCGTATCAAATCGATCCAACACTTTCCCAAGTGGGGTTATTGGACGAGTTCCAGCTCATGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34416
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1365 2916 8 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 1395 2065 8 21
Genomic Location (Zv9):
Chromosome 8 (position 27025363)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26153281
GRCz11 8 26172420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAGGAGGAGTTCCTAACCTGCCTGAGAACTTCCCTTTTAGTACACGA[G/T]AATTTATTGGCTGCATGAAAGACCTGCATATTGATAACAGACCAGTGGAT
Long Flanking Sequence:
GTATATTTGAATGAAGTTATTAAGTTAAAAAATTCAAAATGTCTCCCTCTAAATGTCTGCCTCTATACTCCTAGTATTCAGAAAATTCTTGTAATGTGTATTTAGGATATAGTTGTGTGATATCTGTACTCACAAGGAACCATTTTTACATAAATCCAGCCAAAACGCAGTGTGAGCGGTGAGGTTCAAGGCCCGTCCGATGAGAAGGTTGCTGTCTTGAGTGTAGATGACTGTGATACTGCTGTTTCTCTCCGCTTTGGTGCTCAACTCGGCAACTACAGCTGTGCAGCCCAGGGAAGACAGACCAGCAGCAAGAAGTGAGCGTTCACACACTCACACACGTTCATTAACAGTGTTGGTTTTGCTCCAGAGAGCACATTTAACGTCTGTCCCATTCTCTTTTTGTGTTTTCCCTCTCTCACAGGTCTTTAGATCTGACAGGCCCGCTGTTTTTAGGAGGAGTTCCTAACCTGCCTGAGAACTTCCCTTTTAGTACACGA[G/T]AATTTATTGGCTGCATGAAAGACCTGCATATTGATAACAGACCAGTGGATATGGCAGGATTCATTGCTAATAATGGCACATTACCAGGTAACTGATTATTTTTGATGTGATAGTAAGACGACCAGTATCTGTGGCCTGTTTATATCTGGTTTTAAGATGTTTTTGCTAAATACAGACGTAATAAGGGTCTGTAATGTTTTACATTATAGGCAACCTTCCACTTTTTGTGTCATTTGAAAATACATTTGGTTGGATTGCTTTTAAAGTGTAAAGGCAAAATAGATTGAAACAGCCTTAAAAGATCATTACTAAATGTGTTCTGAGAAAGAGCACTAAAATAAGGTATCCATACGTTGTTGCATTGTTTTAAAACTCAAATTACAAGCAAAATCATAGCACAAGCACATCCACATTCTTGTAATTAGCTTTCTTTCTCGGTTTCTGCTAAGCTGCGTAACGCAAGTATCAGTAGCACTTGTATTGAGTGCTCCTGTGGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9305
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1485 2916 10 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 1515 2065 10 21
Genomic Location (Zv9):
Chromosome 8 (position 27027231)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26155149
GRCz11 8 26174288
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTCGCACCCGATCCAAAGAGGGGGTCCTGCTGCAGGCTCAAGCTGGA[C/T]AGTACACCAACCTGATCTTCCAGGTAAATATGCTTACAAAANNNNNNNNNNACAAAACCA
Long Flanking Sequence:
CTAATGAGTACATTATTGTAGTGTATATTCATGTGATCATTTATGTGAATCGACTGTCTCTTAATTAGGCTGCAGTGCCAAACTGCCTTTCTGCAAATCAAACCCATGCCAAAATGGCGGCACATGTCGGGTGAGCTGGGAGACGTTCTCCTGTGACTGTCCCGTTGGATTTGGAGGGAAAGACTGCAGCTTAGGTAAGATCCATGTAATCGTACAAAGACATACAAATAATTCTCCATTGGCCTTTAGGTGGATCTTAAATCAGAATGCCAGCATCCAACAGGAACTATTAGTAAATGTTAATGTCATAATGGCACTGTTGATCATGGTGTTGTGTTGATATGATTTCCTCAGTGATGTCCCACCCTCATCGTTTCCTGGGGAGCAGTGCACTGTGGTGGGACCTGAAGAATGAAGTCACCATCACCACACCCTGGTACATGGGGCTGGTGTTTCGCACCCGATCCAAAGAGGGGGTCCTGCTGCAGGCTCAAGCTGGA[C/T]AGTACACCAACCTGATCTTCCAGGTAAATATGCTTACAAAAACAAAACCACAAGGAAAGGGTCCAATACTTTCAAATTGACAGTCAATGCATCATTTGATTGCTTCATTAATGGTACATTTGATTTCTTTTTCAACAAAATTTCAATAAAAAATCTTTGTGTGCATTTTAAAGGATTATAATAAACAGTTTAATTGGTGTAAAGAGGAAGTCCTGCCTTATTGGTAGAATGGGGTTGTCACATTTCTGAACTGTATGTGTGCAGAACGAAAGTAAGCACTAAAAGGTGAACTAAAAAGCTGCAGTGTGTGCATGGCCTCAATGTTTTATTTAGCATTTTTCATAACCATCTTCACTTAAAAAAAAACTACAATAGAATACATTTTCATCAAAAGAAAGTACTACTCTAAGTAAAATCAAAGAATTGAAGCCACCATGAATTATAAACAAGGCTTTTCGTTCTGCAAAGCAGCTCTACTGTACAAATGCTCTTTGGCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11108
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 1695 2916 14 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Essential Splice Site 1725 2065 14 21
Genomic Location (Zv9):
Chromosome 8 (position 27032694)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26160612
GRCz11 8 26179751
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAWCTGTGACTGTGAGGATAGTCAYTATGGACAATAYTGCCAACACAGG[T/C]ACACATTCACAAACACTGCATGCGTTCACACTATTACGCCCCAAGTCTNN
Long Flanking Sequence:
GGTTCACAAAACGGTTCACGCTGAAACGTGTTGCTCAAACTGTTGAGCTTGAATGGATGTGATCAGTCATAAAGTTGTGCAGTGAGCTGTTTTATGCAGTTTACTTTCAATGGATGATTGTTTTGAAGCTCTGAATGTACATGTTTTCATTATATGACGCAAATAAACAGTAAATAACGCTGTGCAGCTAGTCTGCAGCAAAATGGACGGTATGAATTTTGTGTTCTACTCAACACAACCCATAATACAGCACAGCCTTGATCTCTGAGTATAGCACACTTCACCTTTAAGTGATAATGTTTGTTTTTTTTATAATTCGAGGTTTGTGTTGTAACAGTTCTCTATTTTTCTATTTAGGATTCTATGGTAAAAGCTGTATGGATGCTTGTCAACTGAACCCATGTGAGAATCAAGCAAAGTGCCACAGGAAGCCCAGCTCCTCTCACGGATACATCTGTGACTGTGAGGATAGTCACTATGGACAATATTGCCAACACAGG[T/C]ACACATTCACAAACACTGCATGCGTTCACACTATTACGCCCCAAGTCTAGGGGACAAAAAATGACCTAAAGGGAATATTAAATATTTGGGTTGCGGTGGTGGATTTCCTAAAAAGATCCCCTTCGATTAACAACTAAACACAGACACTCAAAATTAAATGGATTTATTGTACTGTAGGTAGAAAAATATTAAGGAGCAACTCTTCAGGGTGACCACTGGCCAAAATAAGAAACAAAATAATATTTAAGCAAAATAAACTAAATTACCTATAAATCTTTAAAAAAAAAATACAGGAGCGTACATCACTCCCTAAACATAACCATATTAATCAAAATAAATAGGCAGGCCACCCCTACCACTACAAAGTTTTGGGTCATCAGTCGAAGGCGCAAAATCCACAAGCTCTTTCCCAGACCACTGGACACTGCCATTGCAAGGTACATACAAATAAAGAGTTCAGACACACACACACACACACACGCACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3674
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1780 2916 16 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 1810 2065 16 21
Genomic Location (Zv9):
Chromosome 8 (position 27038311)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26166229
GRCz11 8 26185368
KASP Assay ID:
2260-0665.1 (used for ordering genotyping assays)
KASP Sequence:
CCAGAGAGCGGGCAGTGCCAGTGTCGACCYGGCGTSATTGGCCGCCAGTG[C/A]AACATGTGCGACAATCCGTTTGCTGAGGTCACACAGACCGGCTGTGAAGG
Long Flanking Sequence:
CTGACACAAGCTTCTCTTAAAAAAGATAATAAGACGATGTGCAAGATGCATCATTTTGGAAAAAAAATATTTCTCTTTTATTTACATTTGAAAAAGTCTAAAAGTCAGAATTTGCCAGGCGTATAAATAATTTTGTGCTTGACTGTATACAATGCCTTATTTTATATTTAAACGAAACATTTTACAAAAATTGGTTGCAATAGTTAAAACTTTCCACATTAACTGTGGTGTTTTGGTTTTACATTTCTTCTCTTCAATCACCTGCGGTGTCTTGGCTTAATATTATGCGCATGAAGGATTTTCAGAACCTCTCTCTCTTCATTTGTGTTGTGCATTTGCTCATGTGGATGTTTCTGTGTGCATCAGGAGTTTCATTACCGACGGCGGGGCAGTGACATCTGTCTGCCATGTGACTGTTACCCAGTGGGCTCCTTCTCAAGGTCATGTGACCCAGAGAGCGGGCAGTGCCAGTGTCGACCCGGCGTGATTGGCCGCCAGTG[C/A]AACATGTGCGACAATCCGTTTGCTGAGGTCACACAGACCGGCTGTGAAGGTACAACACCGTCCATACAACCAGTAATCCCTTCATGTTAGCAATATTTGTTAATCCTTTCCTCTCTCGTTTTTCTCAGTGATCTATGATGGTTGTCCGAAGACTATAACATCAGCAATCTGGTGGCCCAGAACTAAATTCAACCTTCCTGCTGCCGTCCCGTGTCCTAAAGGATCAGTGGGTGAGTGTGGAAATTCATATCTGGGTCTTTAATAAATCTTTTTTCTTTTTACATTCCTCTAATGCCTTTTTTTTTTGAAGGAACTGCTATTCGCCACTGTGATGGAGAGAGAGGATGGCTGGACCCTGACCTGTACAACTGCACCTCTCCTCCTTTTGTGGAGCTGAACACAGCCGTGAGGAGCTATAATGATTTATTCATTTAAAGCCTGTTTCACGCAGATTTTTTTTCTTGTGTTAATTCAAGGGATTTGTGTAATTTAAAACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7333
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 1831 2916 18 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Splice Site None 2065 None 21
Genomic Location (Zv9):
Chromosome 8 (position 27038618)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26166536
GRCz11 8 26185675
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTAATAAATCTTTTTTCTTTTTANATTCCTCTAATGCCNNNTTTTTTTTTT[G/T]AAGGAACTGCTATTCGCCACTGTGAWGGAGAGAGAGGATGGCTGGACCCT
Long Flanking Sequence:
CCTCTCTCTCTTCATTTGTGTTGTGCATTTGCTCATGTGGATGTTTCTGTGTGCATCAGGAGTTTCATTACCGACGGCGGGGCAGTGACATCTGTCTGCCATGTGACTGTTACCCAGTGGGCTCCTTCTCAAGGTCATGTGACCCAGAGAGCGGGCAGTGCCAGTGTCGACCCGGCGTGATTGGCCGCCAGTGCAACATGTGCGACAATCCGTTTGCTGAGGTCACACAGACCGGCTGTGAAGGTACAACACCGTCCATACAACCAGTAATCCCTTCATGTTAGCAATATTTGTTAATCCTTTCCTCTCTCGTTTTTCTCAGTGATCTATGATGGTTGTCCGAAGACTATAACATCAGCAATCTGGTGGCCCAGAACTAAATTCAACCTTCCTGCTGCCGTCCCGTGTCCTAAAGGATCAGTGGGTGAGTGTGGAAATTCATATCTGGGTCTTTAATAAATCTTTTTTCTTTTTACATTCCTCTAATGCCTTTTTTTTTT[G/T]AAGGAACTGCTATTCGCCACTGTGATGGAGAGAGAGGATGGCTGGACCCTGACCTGTACAACTGCACCTCTCCTCCTTTTGTGGAGCTGAACACAGCCGTGAGGAGCTATAATGATTTATTCATTTAAAGCCTGTTTCACGCAGATTTTTTTTCTTGTGTTAATTCAAGGGATTTGTGTAATTTAAAACAAATCCATATAATTAACAATTACTGTTTTTATGTAGTGGATCGTAATGGCTCATATTAAAACTGTAGACAGTTTAATTTGCAAAACAAAACACAGAAAACTAAAAGACATTTATTTCAAGGTGTATTCAGACACCTTAGACAGAGAATAACATTTACTCCATGCTGCACTCTTAGAAAAAATGGTACAATGTTGTACAAAAGAAGGTACAAACCCCTGTCACTGGGGCAGTACCTTTTATGCAATGCAATAGTTCCTTAAGACAAAGATACAAATTTGTACCATTGCAGTTTGTACCTTTAAGGACATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34417
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1844 2916 18 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 1871 2065 18 21
Genomic Location (Zv9):
Chromosome 8 (position 27038659)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26166577
GRCz11 8 26185716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTGAAGGAACTGCTATTCGCCACTGTGATGGAGAGAGAGGATG[G/A]CTGGACCCTGACCTGTACAACTGCACCTCTCCTCCTTTTGTGGAGCTGAA
Long Flanking Sequence:
TGTTTCTGTGTGCATCAGGAGTTTCATTACCGACGGCGGGGCAGTGACATCTGTCTGCCATGTGACTGTTACCCAGTGGGCTCCTTCTCAAGGTCATGTGACCCAGAGAGCGGGCAGTGCCAGTGTCGACCCGGCGTGATTGGCCGCCAGTGCAACATGTGCGACAATCCGTTTGCTGAGGTCACACAGACCGGCTGTGAAGGTACAACACCGTCCATACAACCAGTAATCCCTTCATGTTAGCAATATTTGTTAATCCTTTCCTCTCTCGTTTTTCTCAGTGATCTATGATGGTTGTCCGAAGACTATAACATCAGCAATCTGGTGGCCCAGAACTAAATTCAACCTTCCTGCTGCCGTCCCGTGTCCTAAAGGATCAGTGGGTGAGTGTGGAAATTCATATCTGGGTCTTTAATAAATCTTTTTTCTTTTTACATTCCTCTAATGCCTTTTTTTTTTGAAGGAACTGCTATTCGCCACTGTGATGGAGAGAGAGGATG[G/A]CTGGACCCTGACCTGTACAACTGCACCTCTCCTCCTTTTGTGGAGCTGAACACAGCCGTGAGGAGCTATAATGATTTATTCATTTAAAGCCTGTTTCACGCAGATTTTTTTTCTTGTGTTAATTCAAGGGATTTGTGTAATTTAAAACAAATCCATATAATTAACAATTACTGTTTTTATGTAGTGGATCGTAATGGCTCATATTAAAACTGTAGACAGTTTAATTTGCAAAACAAAACACAGAAAACTAAAAGACATTTATTTCAAGGTGTATTCAGACACCTTAGACAGAGAATAACATTTACTCCATGCTGCACTCTTAGAAAAAATGGTACAATGTTGTACAAAAGAAGGTACAAACCCCTGTCACTGGGGCAGTACCTTTTATGCAATGCAATAGTTCCTTAAGACAAAGATACAAATTTGTACCATTGCAGTTTGTACCTTTAAGGACATGATTTGTACCATGGAAAACCAAAATGTACCTTTGGTTTTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10576
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 2045 2916 21 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 None None 2065 None 21
Genomic Location (Zv9):
Chromosome 8 (position 27043509)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26171427
GRCz11 8 26190566
KASP Assay ID:
2260-0666.1 (used for ordering genotyping assays)
KASP Sequence:
ACTCATGTTGTGCTGCCCCCTGCTGCACTAGTGCCACAACGCAATGTCTG[T/A]AAGTCACACAYKCACAAGTTATTAAAGTWCTYCAACAAAGCATAGTAACA
Long Flanking Sequence:
TTCTATTAAGTATTTAATAAATAATGAAGTCATAAAATCACAATACAGTATAATTCAACACAATCCCAATCGCAACACTTATAATAAATCTGGGCCTTTGTTATGCTACACCTGGCAACATATTTAAAGCATTAGTTTTTTTTCAAAGTATAAACTCTGGAGGAAAGCAAGTCTTAGTGAGCTCATGGTTATAAAAATTAAATATTAAAAATATTCAGTCAGGTCCAGTGTGAGAAAGATGAGAAAGATCAATGTGAGACCAATACCTGCAATGCATCAGCAGAAAAACTGCAGCACTACAGAGACACCATCTATTAAAGAAATGCCTGTGTTTGTTTGTTTGTTACAGTCATGACTCTGGATCGTGTTGACAACCACACACACGTGCGGCGCCGCTTTCCACGGTATCACAGTCCTCTGTTCAGGGGTCAAGCGCTCTGGGATGCTCACACTCATGTTGTGCTGCCCCCTGCTGCACTAGTGCCACAACGCAATGTCTG[T/A]AAGTCACACACGCACAAGTTATTAAAGTTCTCCAACAAAGCATAGTAACACTTTCTATGAAGCCTGTATATATAATTCTTAGTAAAATATTATATTGCATGCATAGTCTCTTATAAACAACATTACAATATCGTCTTATAACCACATCATGCTATTTTACGACTGCTTAAAATAACAATGACCTTTGTAATTTTACTTAAAGCAGACAGTACACTTATAAATTATGCATAACACTTTACAACGGAAAGCATATGCTAATTATTATCCATGACTTTTGCATAAAACCCCTAATTTGCTGCTTGTTTATGGTTAATGTAGTTGTTAAGTTAAGCTAAGATATGGTAAAGGATTAGGGGATGTAGAAAATGGTCAAGTAAAATAATTACTAATAAACAGACAATATGCAAGCTAATATGCATATATCTAAAGTTAGAATTGGCTCCCATACTGAAGTGTTATTATTATATGAGAGATTTTTTGTTTCGTTTTGTCACTTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38694
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 2326 2916 30 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 Essential Splice Site 227 407 5 9
ENSDART00000145095 None None 2065 None 21
Genomic Location (Zv9):
Chromosome 8 (position 27053151)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26181069
GRCz11 8 26200208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATATTTAGGCTTTCACACTTATGTGCTCAATAATATGTGTGTGTGTTGA[A/C]GGGCTAGCAGTCGGGTTGGATCCAGAGGGCTACGGTAACCCAGATTTCTG
Long Flanking Sequence:
GTCATTTAATTTTATTACACATAACTTCATTTGTAAACTAATTTGATTTGTTTTCTTTGCATATATGGATTTCTTTGGTTGTTACCATCATCCAGTGAAAATTTCAAGTCAACGGCACCTTTAGAAATATATTTTCTGAGAGAAATGTTGACGTGTTTAATACTTATTTTCCCCAATGTATGTTTTTATTGTTATTTGTTCTCTTTTTTCTAATTTTCTGATTGTTTTCTCGGATTTGATGCAGTTCCTGTGCACAGTGGTTGCCATTTTGCTCCATTACTTCTTCATGTCGGCGTTCGCGTGGCTGTTTGTGGAAGCTCTGCATATTTACCGCATGCAAACAGAAGCACGAAACATCAACTATGGGGCCATGAGATTCTACTATGCTATTGGCTGGGGAGTTCCTGCCATTATTACTGGTACTTTCTCTCACATTGCACACTAAAAACAGATATTTAGGCTTTCACACTTATGTGCTCAATAATATGTGTGTGTGTTGA[A/C]GGGCTAGCAGTCGGGTTGGATCCAGAGGGCTACGGTAACCCAGATTTCTGCTGGATATCCATGTACGATAAGCTCATGTGGAGTTTTGCGGGACCAGTTAGCGTCGTCATACTGGTACTGGCCTTCTATGAGTGTTTATGTGTTGTTTTTAAGCTTTAAGTGTCTTTGTGATTCACTCTTTGTGTTTTGGATGGATGTGGTTTTGAATTAATGATGATGTTTTGTGTTTTACAGATGAATGGTGGGATGTTTTTAATGGTTTTGCGTATGACGTGTAATCCCACTCAGAAGGAGATCAAGAAGCTGCCCGTCATGTAAGTACAACATCATAAACCATATCATCATCAATATTAAATGAATAGTTCACCCAAATATGAATATTTACTTATCATTTACTCACACTTAAGTGGTTTTAAAATTTTATACATTTCTTTCTTCTACCGAATACAAAACATAATAATTAAAGGGATTATTCACCTTAAAATGAAAATTCTGCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21306
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 2828 2916 40 40
ENSDART00000131888 Nonsense 322 441 4 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 None None 2065 None 21
Genomic Location (Zv9):
Chromosome 8 (position 27063620)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26191538
GRCz11 8 26210677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTGATGAGCAGTCGGTCCCGCGAGCAGCTGGAGTCTAATGGTGGAGCA[C/T]AGCCCTGCAGAGAGTGGCTGAGGACCCTGCCGCCCCGCCAGCTCTCACAC
Long Flanking Sequence:
TGAAGAATCGTCTGGGCTGTCCTCCAGCTCTGCAGGGTCTGTCTGCTGTGGGTCGTGCTCCCAGCGAGATGTCCTGGTATAGGACCTCCACACTGGGCCACCGAGGCGTTCCAGCCGCCTCCTACGGTCGCATGTACTCTGGCACTGGCTCACTGTCCCAACCCGCTTCACGATACTCGTCCCGTGAACACCTGGATTCATTAGCAAGACGACAGCGGTCTAGAGACAACCTGGACCTGCTACCCCGACGGCGCGAGCTCGGTGCAGAACACCTGGGTGGGTCCAGAGAGAGGCTGGGTCCTGTTCACAGCATCCACGCATCCAGAGAAGACCTGGTGGGCAGGGGAGGTTTAGCAGGGTTAATGGGGGCCGAGGGGTCATTAAGCGGTTCCAGAACGCAGCTTAACACCCTAACAAGGCAGCAGGCCTCTCGGGAGCACCTTGGAGGGGCTCTGATGAGCAGTCGGTCCCGCGAGCAGCTGGAGTCTAATGGTGGAGCA[C/T]AGCCCTGCAGAGAGTGGCTGAGGACCCTGCCGCCCCGCCAGCTCTCACACCCTGACCCACACCCGCCCTCCTCACCCCCTCCACCAATCACAGAGGAGCCCCACGAATCCCTGCCCTCTCGCCGTGGACGCCTAGACTCTGCGCCCCCGTGTAGGTACCCGTCATCATCTGCGGCTGCACCCGGAGCCCCGTCCAGTCGACCGCCCTCTAGTGAACACCTGGATATCCTGTCGTCCATACTCGCCTCCTTCAGCTCCTCTGTGTTAACCCCGCCCCCTAACCCCGCTGGCCCCTCCCCTTCCCCACCTCCTCCTCTCTCTGCAACCTCTCAGAGCGTCTCCGAAGTGTCACCTGACTCTGAGTAAGTCCTGCCCCTTTTGTGTCACTGAGTGTCCACTTCCTTGTTGATTGACGGTCATCTTTGTGTGCTCATCAAAGATGATTGATTCTGTAGTTCTGCAATTGTATGTCGTAGATTAGAATTTAATGAGTTTTTCATA
Associated Phenotype:
Not determined