Busch Lab

ZMP

vtg2

Ensembl ID:
ENSDARG00000055809
ZFIN ID:
ZDB-GENE-001201-2
Description:
vitellogenin 2 isoform 1 [Source:RefSeq peptide;Acc:NP_001038378]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32401 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29797
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061165 Essential Splice Site 71 1631 None 34
ENSDART00000078328 Essential Splice Site None 834 None 25
ENSDART00000105263 None None 834 None 24
Genomic Location (Zv9):
Chromosome 22 (position 25352871)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24852777
GRCz11 22 24880401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCAAGGTTCTCCTCAGTGCCGCAACAGAGAATACCTTCCTGTTGAAGG[T/A]AATGACTAATAAAACATGCCAGATCTTAGAAAAAAAACACAACCAATACA
Long Flanking Sequence:
TTAATCATTATTTTAGAATTAATATTTGGTCAGCAAATAGTAAAAGTATAAAAGTCTGTTCTTTGCCTGAATTCTTCACAAACCACCAGCCATGAGAGCTGTTGTGCTTGCCTTGACTCTAGCCTTAGTGGGTAAGTCAGATGTTTGAAAGCTCAATGTTTGTCAAATTTTATTTAGATGCAAATCTATTTTGAAGATTTTTTTCTCATTGCTATGTTTGTTTCTTTTAGCGAGTCAACAGAACAAACTTGGTAAGTTTCGTTTTTTGGTTATCTTTTAAGAAGTTAATTTTACCTACAACACAAGAAAATCTAAAATATATACTTAAAAAAAAACATATGTTTCAGTTCCTGAGTTTGCCCATGATAAGACCTATGTGTACAAGTATGAGGCTCTACTCTTGAGTGGTATTGTTCAAGAAGGACTGGCCAAAGCAGGTATTCAAATCAAGAGCAAGGTTCTCCTCAGTGCCGCAACAGAGAATACCTTCCTGTTGAAGG[T/A]AATGACTAATAAAACATGCCAGATCTTAGAAAAAAAACACAACCAATACATTTCCCAACGAGGGTGTATTACAGAAAATGTTACAATCAATTTAATTGAAAATGTCCCTTACAGTTTGTGGATCCTCTTTTCTACGAGTATGCTGGCACTTGGCCCAAGGATCAAGTTTTTCCTGCCACTAAGCTCAACTCAGCACTGGCTGCTCAGCTTCAGACTCCCATCAAGTTTGAGTACGCTAATGGTGTGGTTGGCAAGGTTTTTGCACCAGCAGGAGTCTCTCCCTCAGTCTTGAACTTGTACAGAGGTATCCTCAACATCCTTCAGCTTAACTTTAAGAAGACCCAGAACATCTACGAGCTGCAAGAGGTAAAGTATCTTCCTAGTACATTTTTGATCTATATTTATCTTAGGTTTTACAATCTTCCTTCTAACATTATGACTTGTTCTTCAAGGCTGGAGCTCAGGGAGTTTGCAAAACTCAGTATGTCATCAGTGAGGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29796
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061165 Nonsense 130 1631 4 34
ENSDART00000078328 None None 834 4 25
ENSDART00000105263 None None 834 None 24
Genomic Location (Zv9):
Chromosome 22 (position 25352581)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24852487
GRCz11 22 24880111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGTGGTTGGCAAGGTTTTTGCACCAGCAGGAGTCTCTCCCTCAGTCT[T/A]GAACTTGTACAGAGGTATCCTCAACATCCTTCAGCTTAACTTTAAGAAGA
Long Flanking Sequence:
TTACCTACAACACAAGAAAATCTAAAATATATACTTAAAAAAAAACATATGTTTCAGTTCCTGAGTTTGCCCATGATAAGACCTATGTGTACAAGTATGAGGCTCTACTCTTGAGTGGTATTGTTCAAGAAGGACTGGCCAAAGCAGGTATTCAAATCAAGAGCAAGGTTCTCCTCAGTGCCGCAACAGAGAATACCTTCCTGTTGAAGGTAATGACTAATAAAACATGCCAGATCTTAGAAAAAAAACACAACCAATACATTTCCCAACGAGGGTGTATTACAGAAAATGTTACAATCAATTTAATTGAAAATGTCCCTTACAGTTTGTGGATCCTCTTTTCTACGAGTATGCTGGCACTTGGCCCAAGGATCAAGTTTTTCCTGCCACTAAGCTCAACTCAGCACTGGCTGCTCAGCTTCAGACTCCCATCAAGTTTGAGTACGCTAATGGTGTGGTTGGCAAGGTTTTTGCACCAGCAGGAGTCTCTCCCTCAGTCT[T/A]GAACTTGTACAGAGGTATCCTCAACATCCTTCAGCTTAACTTTAAGAAGACCCAGAACATCTACGAGCTGCAAGAGGTAAAGTATCTTCCTAGTACATTTTTGATCTATATTTATCTTAGGTTTTACAATCTTCCTTCTAACATTATGACTTGTTCTTCAAGGCTGGAGCTCAGGGAGTTTGCAAAACTCAGTATGTCATCAGTGAGGATCCAAAGGCAGACCGCATTACTGTCACAAAGTCTAGGGATCTGAGCCACTGCCAGGAGAGAATTGTGAAGGACATTGGTTTGGCATACACTGAAACATGTGTGGAGTGCACTAAGGTATTGATCTTATTCTGTAGTGTTTTGAATATAAAAAATAGACATTCTCTAGAGCAAAAAAGACAATCACCTTTTTTTTCTCAACAGAGGATCAAAAGTCTGATTGAAACTGCAAATTATAACTACATCATAAAACCATCTGACAGTGGTGCACTGATTGCTGAAGCAACAGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32401
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061165 Nonsense 133 1631 4 34
ENSDART00000078328 None None 834 4 25
ENSDART00000105263 None None 834 None 24
Genomic Location (Zv9):
Chromosome 22 (position 25352571)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24852477
GRCz11 22 24880101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAAGGTTTTTGCACCAGCAGGAGTCTCTCCCTCAGTCTTGAACTTGTA[C/A]AGAGGTATCCTCAACATCCTTCAGCTTAACTTTAAGAAGACCCAGAACAT
Long Flanking Sequence:
CACAAGAAAATCTAAAATATATACTTAAAAAAAAACATATGTTTCAGTTCCTGAGTTTGCCCATGATAAGACCTATGTGTACAAGTATGAGGCTCTACTCTTGAGTGGTATTGTTCAAGAAGGACTGGCCAAAGCAGGTATTCAAATCAAGAGCAAGGTTCTCCTCAGTGCCGCAACAGAGAATACCTTCCTGTTGAAGGTAATGACTAATAAAACATGCCAGATCTTAGAAAAAAAACACAACCAATACATTTCCCAACGAGGGTGTATTACAGAAAATGTTACAATCAATTTAATTGAAAATGTCCCTTACAGTTTGTGGATCCTCTTTTCTACGAGTATGCTGGCACTTGGCCCAAGGATCAAGTTTTTCCTGCCACTAAGCTCAACTCAGCACTGGCTGCTCAGCTTCAGACTCCCATCAAGTTTGAGTACGCTAATGGTGTGGTTGGCAAGGTTTTTGCACCAGCAGGAGTCTCTCCCTCAGTCTTGAACTTGTA[C/A]AGAGGTATCCTCAACATCCTTCAGCTTAACTTTAAGAAGACCCAGAACATCTACGAGCTGCAAGAGGTAAAGTATCTTCCTAGTACATTTTTGATCTATATTTATCTTAGGTTTTACAATCTTCCTTCTAACATTATGACTTGTTCTTCAAGGCTGGAGCTCAGGGAGTTTGCAAAACTCAGTATGTCATCAGTGAGGATCCAAAGGCAGACCGCATTACTGTCACAAAGTCTAGGGATCTGAGCCACTGCCAGGAGAGAATTGTGAAGGACATTGGTTTGGCATACACTGAAACATGTGTGGAGTGCACTAAGGTATTGATCTTATTCTGTAGTGTTTTGAATATAAAAAATAGACATTCTCTAGAGCAAAAAAGACAATCACCTTTTTTTTCTCAACAGAGGATCAAAAGTCTGATTGAAACTGCAAATTATAACTACATCATAAAACCATCTGACAGTGGTGCACTGATTGCTGAAGCAACAGTTAAGGAAGTACAT
Associated Phenotype:
Not determined