Busch Lab

ZMP

smc1a

Ensembl ID:
ENSDARG00000055754
ZFIN ID:
ZDB-GENE-090506-9
Description:
structural maintenance of chromosomes protein 1A [Source:RefSeq peptide;Acc:NP_001155103]
Human Orthologue:
SMC1A
Human Description:
structural maintenance of chromosomes 1A [Source:HGNC Symbol;Acc:11111]
Mouse Orthologue:
Smc1a
Mouse Description:
structural maintenance of chromosomes 1A Gene [Source:MGI Symbol;Acc:MGI:1344345]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32449 Nonsense Available for shipment Available now
sa32450 Nonsense Available for shipment Available now
sa44003 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32449
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078148 Nonsense 3 1232 1 26
Genomic Location (Zv9):
Chromosome 23 (position 28936224)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28766791
GRCz11 23 28693332
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCGCATCTAACACGCCCCTCTCTGAACAATCAGACAGTATGGGATA[T/A]TTAAAACTAATCGAGATCGAAAATTTCAAATCATATAAAGGACGCCAAAT
Long Flanking Sequence:
CGGTTGATGTTGTGATCTTCGATGTCGTATGCAATGCATATTATTGTATTTTAGTATTGCATAGTTTGTTGTGGGGTAAAGATGCAGAAGGGCATTAAAAATTGTTTTTTTTGTATCATTATCATAGTTCATATTCAGGTCATGTCATGGTACTTAAAAAGAGACTGAGGGAAGCAAAATACTCGAATATGTTTTTGCGTGTGTTTGCTACCAAAATGGCCTGAGCGCGCCATATCTGTAGGACTTTTATTTTGCCTGAATTTAGCTCTAGACAGGGGGCGTGTTCGCGACGCGTCTGGGCATTTAATTCAGTGCGTTATAAAATAATCTTACAAGATTATTATGGTTTCAGTGGTTTACATTAACCTCTGAAACACAGTATTAAGCATCTAATGACCGTTTTTGTCTCCAATTAAACGACGTTTGTAGTAGCTCATCGACACAGAATTCAGCAGCGCATCTAACACGCCCCTCTCTGAACAATCAGACAGTATGGGATA[T/A]TTAAAACTAATCGAGATCGAAAATTTCAAATCATATAAAGGACGCCAAATAATAGGACCGTTTCACAAGTTTACAGCAATAATTGGGCCAAATGGATCAGGTAAGTGTTTTCTCATCATGTTCTGATGCAGCGCAGTGCCTGCAACACTGCTCAGCTCTAATAACGTGCAAAGCTGTATTAACGCTGTATTAACATAAATCCAGCTATAGCTATGTTTCTGGCGTATAAATGAATTACTTTTCCTTTTTATCAACGTCTGTCACGTTTATGCCTAGTGGTTGTTTTTTATTGCCACGTATTTCTGCCATTCTATTATATTCAGCAGGTCCCATCTAAACGTCTTAGAAATGTAAAGATTAGTCAAATAATTATGTGCATTCAAAATGTACTTCGCTATTAATTTAAATGATAACTAATATACCTTGCTAATATTAACCATGGCCTTGCAAAAAAAAATGTATATACATAGAAAAGAATATAGAGAAAATAAAGACCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32450
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078148 Nonsense 436 1232 8 26
Genomic Location (Zv9):
Chromosome 23 (position 28941781)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28772348
GRCz11 23 28698889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAAATAAAGCAGAAGATCCGAGAGATTGAAGAAAACCAGAAGCGTATT[G/T]AAAAGCTGGAGGACTATATTGCAACCAGCAGGTATTTTAGTGAACATTAT
Long Flanking Sequence:
CAGAAGATGTACAAGAAGCGTAAGGCGGACATCGAGGAACTGGACCGTGAGCAAGGGGCTGTGGAGATGTCAAGGCAGGAGTTTGAGGAGCGGATGGAAGAAGAGGCACAGAGTCAAGGCCAAGATCTGACACTGGAGGAGAACCAGGTCAGTCTATGTTAATTGCTTGATGTACTACATGAAAAACGAGGCATACAGCTTTCATTTTACACTTATACTGTTATTTCAGGTAAAACAGTATCACAGGCTGAAGGAGGAGGCTAGTAAGCGGGCAGCTACTTTGGCACAGGAGCTGGAGAAGTTTAACAGGGACCAAAAGGCTGACCAGGATAGACTTGATTTGGAGGAGAGGAAGAAAATTGAGACTGAGGTACAGTGAGAAATTTATCATATTTTTTTGTGCCTTTGATTGGCTGATTTATCATGTTATGTTTTTGATTAAACTACAGGCCAAAATAAAGCAGAAGATCCGAGAGATTGAAGAAAACCAGAAGCGTATT[G/T]AAAAGCTGGAGGACTATATTGCAACCAGCAGGTATTTTAGTGAACATTATAAAATGTCTTCAAAAAATCAGCAAGGTTTTCTTGATATAAGAATAGTTCCTTTATGGCCATCTGTATATTTATACAATATATAGAAAAGAAACAACATATAATATAGCCTAATACAATATATAAATATTATTTTATTCAGTGAGTATACATTAAAAAGTAAAAATAAAGACAAAAAGTAATCATAAAGACTTTATTAATCAAAGAATCTTGAAAAAAAAATCTGCAAAATAATTTTAAGAAAATCCAAAAATATTTAACTGTTTTCATTATTGATAATGATAAAAATGGTTCAAATTATTAAAAAAATGGGCCAAACTAACTAATTTCTGAAGGATCATTTTATATAATAAATATATGAAAATGTTAATTCTTTTTATTTCAAATGTTATTTTGGCAGTTCATCCACTGTGGCAACCCCTGATTAAGGGACTAAGGCGAAGGAAAATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44003
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078148 Nonsense 753 1232 15 26
Genomic Location (Zv9):
Chromosome 23 (position 28949022)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28779589
GRCz11 23 28706130
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTGGAGAGCGAGCTGGCAAATTTTGGTCCACGAATCAATGACATCAAA[C/T]GAATCATCCAATCACGAGAGAGGGACATAACACAGCTAAGAGATCGTATG
Long Flanking Sequence:
CAATTATTATTATAATAATAATTTAGTAGTAACTATTATTATATAGTAGTAATCAGTATTTATTTTTAATAATGTTTTATGTAATTTGTATAATTTGCTAGATTTTTATTTGTATGCTTTTGTGGAAATAAAATAACTTGACAGTCTTTTTTAAAATCAAGCTGGCTTTTACATCTCTCGTGTTTGTCTCTTCAGGAACAAATGAAGGCAAAGAGGAAGGAGGCAGAGCTCAGACAGGTCCAGTCTCAGGCTCACGGACTGCAGATGAGACTAAAATACTCTCAGAGTGATCTGGAACAGACAAAAACCCGCCACCTCTCTCTGAACATGCAGGTGCACAATACAAGAAATGCTTCTCTCAAGAAATATAGAAAATTGGATTAAAAACAAAGGCATCTGAGTTACAGTGCATTTTTCAAAATGCATGCATGTCTTTGTAGGAGAAATCAAAGTTGGAGAGCGAGCTGGCAAATTTTGGTCCACGAATCAATGACATCAAA[C/T]GAATCATCCAATCACGAGAGAGGGACATAACACAGCTAAGAGATCGTATGAACCTGGTAACACTTTTAAAATGCCAAGTCATAAATAAGTCATATATTTTGCTATTCACCCAGATTATTGATTTTCTAATCATTATTACTTGCCATGGTCATTCGTAGGTAGAGGATGAGGTCTTTTTTGAATTCTGCAAAGAGATCGGTGTGCGAAATATCAGAGAGTTTGAAGAGGAAAAAGTGAAGAGGCAAAACGAGATTGCCAAAAAACGGTACATTTATTAACAACAATAATTACAGTAGAAAGTCAATATTATTAGCCATAATTCCCAAATTATGTTTAACATAGCAATGATTTTTTTACAGTATTTCCAATAATATTTTTTTCTTTAGTGAAAGTCTTATTTGTTTTATTTTGTCTAGAATAAAAGCAGTTTTTAATTTCTTTAAAAACATTTTAGTCATAATTTTTTGTATCGATTGTCTACAGAACAAACAATCATTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4258
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078148 Essential Splice Site 1096 1232 23 26
Genomic Location (Zv9):
Chromosome 23 (position 28955218)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28785785
GRCz11 23 28712326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATTCTAGTAGGATTTCTATTTTCTTATTGTAATGGATAATGTTTTATC[A/T]GGCATTCCTTGGACCAGAGAACCCAGAAGAACCATATTTAGATGGAATCA
Long Flanking Sequence:
GAGTTCTCCATGACATTTAATGATTTGATCCAAGACTCCTGGTTCTAAAATTTAAATTAAAATTGTTAATTTACATCTTAAAATTTGTTTTGTCAAATTTAAATGATTTTAAACTATTTTGAGGATTTGCCCTAAGTGGGTCTCAACGTTTCATGTTTATCCTTTTAAGCTACTATATTTGGTAGCTTTAAATAAATTAATAAATCACTCATATGCTGTTGATTTGTCTTACAGAGTTTGAAGCTGCCCGGAAAAGAGCGAAGAAAGCCAAACAAGCATTTGAGCAGATCAAAAAAGAGAGGTTTGACCGATTCAATGCCTGTTTTGAGTCTGTTGCCACAAACATTGATGAGATCTACAAAGCGCTTTCACGTAACAGCAGTGCACAGGTTAATAAAACACTCTGAATACGGATCCCACTTCTCATTTATTTATTTTTTTTATTAAACTACATTCTAGTAGGATTTCTATTTTCTTATTGTAATGGATAATGTTTTATC[A/T]GGCATTCCTTGGACCAGAGAACCCAGAAGAACCATATTTAGATGGAATCAACTACAACTGTGTGGCCCCAGGAAAGAGGTTCAGGCCCATGGATAACCTTTCAGGAGGAGAGAAGACTGTAGCAGCTTTAGCTCTCCTTTTTGCTATTCACAGGTATAACAAAGAAATGTAAAAAAAAATAAATAAATAAAAAAATAAATTATAAATAAAATAAAATTATAAAATAATTATAAAAAAATATATATATATATATATTCTCACTTTAAAGATATATTTTTTACTTCTAGAGTGACCTAGCAGATTAACAAAAATAAAGCATATTTTGAAACAACTTTTACCTGCTGGACTGTCCACAACCCAAACTCTTAATAGTGGTTGACCTGGAAAGTGAGTGACGGATTTGAGTGGACCTTATTTACACTTGTGCTGCTCCAATCCCTTAAGACTTTCCTTCATCTCTCGAACACAAATTAAGATATTTTAGTTGAACCCAAGAGCCC
Associated Phenotype:
Not determined