Busch Lab

ZMP

ankrd54

Ensembl ID:
ENSDARG00000055743
ZFIN ID:
ZDB-GENE-040718-318
Description:
Ankyrin repeat domain-containing protein 54 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGX3]
Human Orthologue:
ANKRD54
Human Description:
ankyrin repeat domain 54 [Source:HGNC Symbol;Acc:25185]
Mouse Orthologue:
Ankrd54
Mouse Description:
ankyrin repeat domain 54 Gene [Source:MGI Symbol;Acc:MGI:2444209]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31331 Nonsense Available for shipment Available now
sa31330 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26066
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078137 Nonsense 120 315 1 8
Genomic Location (Zv9):
Chromosome 3 (position 26998928)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25905308
GRCz11 3 26036179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAGCAGGGTGAGGCGGCTGGCAAGAGCCCGGAGGAACATGGGGCCCATT[G/T]GAAAAGACCTGCATGGTGTGTGTACACGAGCAGAAGATACACACTACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31331
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078137 Nonsense 224 315 6 8
Genomic Location (Zv9):
Chromosome 3 (position 26995711)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25908525
GRCz11 3 26039396
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTCTGAATGTCTCTTTAGGTGCTCGTGTTGATGCTCTGGATCGTGCT[G/T]GAAGGACTCCTCTCCATCTCGCCCGCTCCAAGCTCAACATCTTGCAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31330
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078137 Essential Splice Site 291 315 7 8
Genomic Location (Zv9):
Chromosome 3 (position 26992455)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25911781
GRCz11 3 26042652
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTAGAGCACATCTCAACCCAGCTGCAGAACACCCGCACCAGAGAACAGG[T/G]AAACACACACATCTGAGATCTAACACAGCCCTTTAATAATGTACAAACAG
Associated Phenotype:
Not determined