Busch Lab

ZMP

ube3a

Ensembl ID:
ENSDARG00000055737
ZFIN ID:
ZDB-GENE-041114-190
Description:
ubiquitin-protein ligase E3A [Source:RefSeq peptide;Acc:NP_001007319]
Human Orthologue:
UBE3A
Human Description:
ubiquitin protein ligase E3A [Source:HGNC Symbol;Acc:12496]
Mouse Orthologue:
Ube3a
Mouse Description:
ubiquitin protein ligase E3A Gene [Source:MGI Symbol;Acc:MGI:105098]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9479 Nonsense Available for shipment Available now
sa18845 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9479
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078128 Nonsense 53 857 3 11
ENSDART00000078128 Nonsense 53 857 3 11

The following transcripts of ENSDARG00000055737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 38709095)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38780695
GRCz11 6 38778231
KASP Assay ID:
2259-7821.1 (used for ordering genotyping assays)
KASP Sequence:
TTCCAGCGCATGGATAACAATGCAGCAGCCATCAAGGCCCTGGAGTTATA[T/A]AAGAATAATGCCAAACTGTGTGATCCTCATCCCTCTAAGAAAGGAGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18845
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078128 Nonsense 53 857 3 11
ENSDART00000078128 Nonsense 53 857 3 11

The following transcripts of ENSDARG00000055737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 38709095)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38780695
GRCz11 6 38778231
KASP Assay ID:
2259-7821.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCAGCGCATGGATAACAATGCAGCAGCCATCAAGGCCCTGGAGTTATA[T/A]AAGAATAATGCCAAACTGTGTGATCCTCATCCCTCTAAGAAAGGAGCCAG
Associated Phenotype:
Not determined