Busch Lab

ZMP

si:dkeyp-69e1.8

Ensembl ID:
ENSDARG00000055731
ZFIN ID:
ZDB-GENE-070912-676
Description:
hypothetical protein LOC100001340 [Source:RefSeq peptide;Acc:NP_001120992]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14405 Nonsense Available for shipment Available now
sa6896 Missense, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14405
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078127 Nonsense 205 238 3 3
ENSDART00000143697 None 321 334 4 4
Genomic Location (Zv9):
Chromosome 3 (position 26964762)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25939474
GRCz11 3 26070345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGGGCTGTTCGTCGGGGGGTCTTTAGRAGGGGCCATGGGAGCAACGGT[G/A]GGCTCTGTGRCCAYAGAGGTGGAGAGAAGGAAAAAGAAATGAGCAACTAA
Long Flanking Sequence:
ATGGACCAGCTGCCAGAGGATGTTCTTCTTAGCGAGTTTCTCAGTACAGAACGAGTCGATTTATTGGAGCTCGTGCAAAAATGCGGAGAGCGAGAGCATCCTTTGAGGCCAGAGGAGAAAGACAACGTTGAGGAGCTGCTGACGAAGGTGGAACGGATGGTAAAAGAAAGCGGGACACCGTTTTACACATGCCCTCTTTTGCAGGAGGCAGAGAGAAGAGTGAAGGAGAAGGAGGAGGAGATTTCGAGGAGTCGAGGAGAGAGTGATTCTGAGGGAACAAGAGCTGAAGCGGAGAGAAGTGTGGATGATCTCCTGGTGGAGGGAATCACAGAGCTCTGCGTCGCCAAGCCTGAGGACTTGCCATTTATGCGCTGGTTGTGGGACAGTGTGGTCGGGTGGCTTCTGTGGCTGCCGAAAATGGTGAGGGGCAGTACTCTGCTGGGCTCCATTGTGGGGCTGTTCGTCGGGGGGTCTTTAGGAGGGGCCATGGGAGCAACGGT[G/A]GGCTCTGTGGCCACAGAGGTGGAGAGAAGGAAAAAGAAATGAGCAACTAAACAGTTTGGTAACAGCTTATTGTATTTTTCATTACATTATAAAATGTTCGCCCCAATAAACAGATCAGTTATTCTTATGCATTCAATTAGCTAGGGTAACACTTTACAGTAAGGTTGCATTAGGTGATATATTTATTAACATGAACAATACATTTATTACAGTATTTATTCATTTTTGTTAACATTAATGAAAACACAGTTGTTTATTGTTAGTTGTTGTTAACTCAGTACATTAACTAATGTTAACTGTTAACAATAACAACTTCAATATGATTTTAGGAATCATTTTTGAATGCTGAAATTAACATTAACAATGCTTGATAAATGCTGTGCAAGTATTTTTTATTCTTAGTTCATGTTAGTAAATACTTTAAGATGAATTAATGAACCTCATTGTAAAGTGTGGTCTAATTAAGTTTTGCATGCTGATAATTAAATAAAATATTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5203
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078127 Nonsense 208 238 3 3
ENSDART00000143697 Missense 325 334 4 4
Genomic Location (Zv9):
Chromosome 3 (position 26964752)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25939484
GRCz11 3 26070355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGTCGGGGGGTCTTTAGRAGGGGCCATGGGAGCAACGGTGGGCTCTGTG[G/A]CCACAGAGGTGGAGAGAAGGAAAAAGAAATGAGCAACTAAACAGTTTGGT
Long Flanking Sequence:
TGCCAGAGGATGTTCTTCTTAGCGAGTTTCTCAGTACAGAACGAGTCGATTTATTGGAGCTCGTGCAAAAATGCGGAGAGCGAGAGCATCCTTTGAGGCCAGAGGAGAAAGACAACGTTGAGGAGCTGCTGACGAAGGTGGAACGGATGGTAAAAGAAAGCGGGACACCGTTTTACACATGCCCTCTTTTGCAGGAGGCAGAGAGAAGAGTGAAGGAGAAGGAGGAGGAGATTTCGAGGAGTCGAGGAGAGAGTGATTCTGAGGGAACAAGAGCTGAAGCGGAGAGAAGTGTGGATGATCTCCTGGTGGAGGGAATCACAGAGCTCTGCGTCGCCAAGCCTGAGGACTTGCCATTTATGCGCTGGTTGTGGGACAGTGTGGTCGGGTGGCTTCTGTGGCTGCCGAAAATGGTGAGGGGCAGTACTCTGCTGGGCTCCATTGTGGGGCTGTTCGTCGGGGGGTCTTTAGGAGGGGCCATGGGAGCAACGGTGGGCTCTGTG[G/A]CCACAGAGGTGGAGAGAAGGAAAAAGAAATGAGCAACTAAACAGTTTGGTAACAGCTTATTGTATTTTTCATTACATTATAAAATGTTCGCCCCAATAAACAGATCAGTTATTCTTATGCATTCAATTAGCTAGGGTAACACTTTACAGTAAGGTTGCATTAGGTGATATATTTATTAACATGAACAATACATTTATTACAGTATTTATTCATTTTTGTTAACATTAATGAAAACACAGTTGTTTATTGTTAGTTGTTGTTAACTCAGTACATTAACTAATGTTAACTGTTAACAATAACAACTTCAATATGATTTTAGGAATCATTTTTGAATGCTGAAATTAACATTAACAATGCTTGATAAATGCTGTGCAAGTATTTTTTATTCTTAGTTCATGTTAGTAAATACTTTAAGATGAATTAATGAACCTCATTGTAAAGTGTGGTCTAATTAAGTTTTGCATGCTGATAATTAAATAAAATATTTTTTCACCACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6896
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078127 Nonsense 210 238 3 3
ENSDART00000143697 Missense 326 334 4 4
Genomic Location (Zv9):
Chromosome 3 (position 26964748)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25939488
GRCz11 3 26070359
KASP Assay ID:
554-5188.1 (used for ordering genotyping assays)
KASP Sequence:
CGGGGGGTCTTTAGRAGGGGCCATGGGAGCAACGGTGGGCTCTGTGRCCA[C/T]AGAGGTGGAGAGAAGGAAAAAGAAATGAGCAACTAAACAGTTTGGTAACA
Long Flanking Sequence:
AGAGGATGTTCTTCTTAGCGAGTTTCTCAGTACAGAACGAGTCGATTTATTGGAGCTCGTGCAAAAATGCGGAGAGCGAGAGCATCCTTTGAGGCCAGAGGAGAAAGACAACGTTGAGGAGCTGCTGACGAAGGTGGAACGGATGGTAAAAGAAAGCGGGACACCGTTTTACACATGCCCTCTTTTGCAGGAGGCAGAGAGAAGAGTGAAGGAGAAGGAGGAGGAGATTTCGAGGAGTCGAGGAGAGAGTGATTCTGAGGGAACAAGAGCTGAAGCGGAGAGAAGTGTGGATGATCTCCTGGTGGAGGGAATCACAGAGCTCTGCGTCGCCAAGCCTGAGGACTTGCCATTTATGCGCTGGTTGTGGGACAGTGTGGTCGGGTGGCTTCTGTGGCTGCCGAAAATGGTGAGGGGCAGTACTCTGCTGGGCTCCATTGTGGGGCTGTTCGTCGGGGGGTCTTTAGGAGGGGCCATGGGAGCAACGGTGGGCTCTGTGGCCA[C/T]AGAGGTGGAGAGAAGGAAAAAGAAATGAGCAACTAAACAGTTTGGTAACAGCTTATTGTATTTTTCATTACATTATAAAATGTTCGCCCCAATAAACAGATCAGTTATTCTTATGCATTCAATTAGCTAGGGTAACACTTTACAGTAAGGTTGCATTAGGTGATATATTTATTAACATGAACAATACATTTATTACAGTATTTATTCATTTTTGTTAACATTAATGAAAACACAGTTGTTTATTGTTAGTTGTTGTTAACTCAGTACATTAACTAATGTTAACTGTTAACAATAACAACTTCAATATGATTTTAGGAATCATTTTTGAATGCTGAAATTAACATTAACAATGCTTGATAAATGCTGTGCAAGTATTTTTTATTCTTAGTTCATGTTAGTAAATACTTTAAGATGAATTAATGAACCTCATTGTAAAGTGTGGTCTAATTAAGTTTTGCATGCTGATAATTAAATAAAATATTTTTTCACCACAAATTATG
Associated Phenotype:
Not determined