Busch Lab

ZMP

bco2a

Ensembl ID:
ENSDARG00000055722
ZFIN ID:
ZDB-GENE-030131-8039
Description:
Novel protein similar to beta-carotene oxygenase 2a (Bco2a) [Source:UniProtKB/TrEMBL;Acc:B8JLH3]
Human Orthologue:
BCO2
Human Description:
beta-carotene oxygenase 2 [Source:HGNC Symbol;Acc:18503]
Mouse Orthologue:
Bco2
Mouse Description:
beta-carotene oxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:2177469]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13144 Nonsense Available for shipment Available now
sa1284 Essential Splice Site F2 line generated Not yet available
sa20447 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13144
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078117 Nonsense 145 535 3 11
ENSDART00000133981 Nonsense 178 569 4 12
ENSDART00000147963 Nonsense 180 257 5 7

The following transcripts of ENSDARG00000055722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 31704610)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29465440
GRCz11 5 30065593
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCCAACAGATAATGCCAGCGTCAACTTTGTTAAGTACAAGGGGGACTA[T/A]TATGTGAGCACWRAGACAAACTACATGCACAGAGTGGATCCAGAAACTTT
Long Flanking Sequence:
TCAACATTATTTGATGTTATTATTGGACATCAAAATAATATTGTCCTTAGACGCTGGCTAGACATTGAATTTTGGTCACCTGACATCACAACCTAAATCTAACCTAATATTAACGTCTTATGACATTGTGTGGCTGCTAACTAAATGCACTGCAGAATGTTACATTTACACATATTCACAAATTACATGTAAATGCATCAACTATTAAAAGCATAATACTCACTACTCATGAGTACTTTTAAAAGGGATACTTTTCCTTCTATTTGAGTAATATTTACAACTGGTACTTTTACTCTACTAACAGTACATTTTTAGGCATGCAATGCTACTATTACTTAAGTATGCTTTTTCAGTACTCTTTCCACCACTGCTTAAAAGTAATCAAAGTAATACAAAAATTTAAATGAATCAAATGTATTTATGACACTGATTTCCTTCTCTCCAATTCCAGAGCCAACAGATAATGCCAGCGTCAACTTTGTTAAGTACAAGGGGGACTA[T/A]TATGTGAGCACTGAGACAAACTACATGCACAGAGTGGATCCAGAAACTTTGGAGTCCAAACAGAAGGTATGAAGTAAAAACGATTTTTTTTTATGTAAAATCAAATCTTAAGGGTTAGGTCACCCAAAAAATATGTTATTAATTACACCCTCTCATGTCATACCAATTTCCTGAGGTCTTTGATCATTTTCAGTCTCAGGATGTTTAAAATCCTGAAAAGGTACATCATATAAAAATAAATGTATAATGTATGTAACACAAACATAAAAATAAGTAATTTCTACATGGTTTTTTGTGTTCTCAGAGCTTCATACGATTACAGTTGCATGACTTAAGTCACGGAATGTTTTGACAAGGTTTTTGGTTTCTTTTCTGGACTTTAATGGATTTGGATCGTTGTATATGGAGGATGAGAAAGCTATCTGATTTCACCCAAAAAAAAACATAATTTGTGTTCCAAAGAAGAACATTTGTATTAATGGAACAACATGAGGATGAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa582
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078117 Nonsense 150 535 3 11
ENSDART00000133981 Nonsense 183 569 4 12
ENSDART00000147963 Nonsense 185 257 5 7

The following transcripts of ENSDARG00000055722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 31704597)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29465427
GRCz11 5 30065580
KASP Assay ID:
554-0492.1 (used for ordering genotyping assays)
KASP Sequence:
ATGCCAGCGTCAACTTTGTTAAGTACAAGGGGGACTATTATGTGAGCACW[G/T]AGACAAACTACATGCACAGAGTGGATCCAGAAACTTTGGAGTCCAAACAG
Long Flanking Sequence:
ATGTTATTATTGGACATCAAAATAATATTGTCCTTAGACGCTGGCTAGACATTGAATTTTGGTCACCTGACATCACAACCTAAATCTAACCTAATATTAACGTCTTATGACATTGTGTGGCTGCTAACTAAATGCACTGCAGAATGTTACATTTACACATATTCACAAATTACATGTAAATGCATCAACTATTAAAAGCATAATACTCACTACTCATGAGTACTTTTAAAAGGGATACTTTTCCTTCTATTTGAGTAATATTTACAACTGGTACTTTTACTCTACTAACAGTACATTTTTAGGCATGCAATGCTACTATTACTTAAGTATGCTTTTTCAGTACTCTTTCCACCACTGCTTAAAAGTAATCAAAGTAATACAAAAATTTAAATGAATCAAATGTATTTATGACACTGATTTCCTTCTCTCCAATTCCAGAGCCAACAGATAATGCCAGCGTCAACTTTGTTAAGTACAAGGGGGACTATTATGTGAGCACT[G/T]AGACAAACTACATGCACAGAGTGGATCCAGAAACTTTGGAGTCCAAACAGAAGGTATGAAGTAAAAACGATTTTTTTTTATGTAAAATCAAATCTTAAGGGTTAGGTCACCCAAAAAATATGTTATTAATTACACCCTCTCATGTCATACCAATTTCCTGAGGTCTTTGATCATTTTCAGTCTCAGGATGTTTAAAATCCTGAAAAGGTACATCATATAAAAATAAATGTATAATGTATGTAACACAAACATAAAAATAAGTAATTTCTACATGGTTTTTTGTGTTCTCAGAGCTTCATACGATTACAGTTGCATGACTTAAGTCACGGAATGTTTTGACAAGGTTTTTGGTTTCTTTTCTGGACTTTAATGGATTTGGATCGTTGTATATGGAGGATGAGAAAGCTATCTGATTTCACCCAAAAAAAAACATAATTTGTGTTCCAAAGAAGAACATTTGTATTAATGGAACAACATGAGGATGAATAATTTTATAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1284
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078117 Essential Splice Site 245 535 6 11
ENSDART00000133981 Essential Splice Site 278 569 7 12
ENSDART00000147963 None None 257 None 7

The following transcripts of ENSDARG00000055722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 31701418)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29462248
GRCz11 5 30062401
KASP Assay ID:
554-1199.1 (used for ordering genotyping assays)
KASP Sequence:
TTMTGAATGTATAGCACTAAAACACATANATTTTATTTCCCTGAACCTTTC[A/T]GGCATGTCAGAGAACTACGTAGTGTTCATCGAGCAGCCTATTATAATGGA
Long Flanking Sequence:
ACGGTGCCACCGCTCATCCACACTTTGATCCAGACGGCACAGCTTACAACATGGGCAACTCCTACAGAAACAAAGGTTAGATTCCTGTCTTTCTCTTTTGCACTAAGCAAATTAAGCATTGTATGAGGTCATGTTCATACTAGGAAATGTTTTCTAGGTGCTATGTACAACATCATCAGAGTCTCTCCAGAAAGAGACGGCCCCAAGGATACGCTAGAGGGAGCCAAAATATTATGCTCTATCGCCCCCCGTGACAAATCCAAACCCTCTTATTACCACAGCTTTGGTGAGTGAATATGAAAATCTGTCCCGTTTATTATCTCCACCTCAACTACACAAGAACGACTATCGTAATAAATTTTTACACTTTTCTGTATGTAATAAAGCCATGCTTTTTTTAACTGCAAGGCACTCTGAATTATATAATCATATTGTCTGAATAGAGTGGTCTTATGAATGTATAGCACTAAAACACATAATTTTATTTCCCTGAACCTTTC[A/T]GGCATGTCAGAGAACTACGTAGTGTTCATCGAGCAGCCTATTATAATGGATCTGTTTAAGATAATAACCGGCAGACTATGGGGCAACTCAATAAATCGGGGTATTTACTGGGACCCCAACCAGGAAACCATTTTTCACCTTATTGACAAACAAACTGGAAAGGTGAGGCAATCTTTTAAGACATTTACAGTAGTATTTCTCAGAGGCATTGAGAATAATGCAGATGATCTCTCTTATGAGTTTATCCATACAGTTTACAGTATATTTGTGCATTGATTGTGCTTTATACGTTTCAGTGAGAGCTGATGAACATAACGATATTATGTGGTTGTATTTGTAATGAAAGTATAGTGATACAGCACTTAATATAGTTGTTAATGAATTATGCATAATACATGTAACAATCCCTAATCCTAACTCGCGTAATATAGTAACTCTAACTCTATAGTATAGTAAGTACAGTGCGCAGCATATATAAGTACACCCCTCACAAATCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20447
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078117 Nonsense 381 535 8 11
ENSDART00000133981 Nonsense 414 569 9 12
ENSDART00000147963 None None 257 None 7

The following transcripts of ENSDARG00000055722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 31699783)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29460658
GRCz11 5 30060811
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGTCGTTTTGTTCTGCCGCTCCACATCAGCAGTGAAACACCTCTGGAA[C/T]AGAATCTCAACACTCGTCTTGACAGCACCGCCACTGCCATCTGCCGCACT
Long Flanking Sequence:
ACTTATAAATATTTAATATTACTCGGTAGTTACATAAAGTTATACTGTAACTGCTTCACCCTTTAATAAAGTGTTATGTAATTGACTGCTCTGCCTGTCTGTCTGTGCAGGAGATGCCAGTAAAGTACTACACCAAGGCTCTGTCCACCTTTCATCAGATCAATGCGTTTGAGCAGGACGGTTTCCTCATGTTAGACATGTGCTGCTCTGATGATGGAGAGGCCATAAATAACTTCCTGATCCAGAACATGCGCCAGTCAGGAGAGGCTCTGGATGAGGTGATGTTACTCTCTGTTTGTCCTACAGTAATACTACATTAACTACATTAATACTACTGTATAACAGCAGGTGCCATGTATACTGTTAATATAATTATTATGACATTATTTGTCTAATTTTCTGTGTATATTTTTCTCTCTCAGATGTATAACACAATGAGTCGGCCACTGCCCCGTCGTTTTGTTCTGCCGCTCCACATCAGCAGTGAAACACCTCTGGAA[C/T]AGAATCTCAACACTCGTCTTGACAGCACCGCCACTGCCATCTGCCGCACTAAAACTCAGGTGTCCTCTTTGACTGAGTTACACATGTAGTACATTGTATCATATCCTTTGTTTTTTCTCCGGGTGCTCCGGTTTCCCCCACAAGTCCAAAGATATGCGGTATAGGTGAATTAAGTAAACTAAATTGGCCATAGTATAAGCATGGGTTTTAACCACAGCGGTTCGAACTGTAGTTCTGCCGAGCGACTAAAAAGTTATCAGTATGATGGTAAAAAACTATACATTTCTAGTCACCATTCTTCTGCAATCTCATTACAAAAATGGAAATAAGGGCAGTATTAGTAGCTATAAATGTAGAAGAGCGTTGATATTATGTGATTGTATTTTATTGCAATATGGAACAATTAAATGTTGATGTTAAATCAAAAGTAATTCACAAGTACTTGAAAATGAGATGATTTAATGACAATAATTATCTATGGTCACAACTGAATTAATTAC
Associated Phenotype:
Not determined