Busch Lab

ZMP

LOC100007472

Ensembl ID:
ENSDARG00000055720
Human Orthologue:
CCDC41
Human Description:
coiled-coil domain containing 41 [Source:HGNC Symbol;Acc:17966]
Mouse Orthologue:
Ccdc41
Mouse Description:
coiled-coil domain containing 41 Gene [Source:MGI Symbol;Acc:MGI:1924298]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40283 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40283
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078101 Nonsense 566 685 13 16
Genomic Location (Zv9):
Chromosome 4 (position 19062204)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20405539
GRCz11 4 20126514
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTTTGGTCTGTTTTCTTATCCAGAGGAAAACAATGACTGAACTGAAA[G/T]AAAACAAACTCAAAGACAAGATTCAGCTCCTGGAAGCCAAGATAGCAGAA
Associated Phenotype:
Not determined