Busch Lab

ZMP

capn8

Ensembl ID:
ENSDARG00000055715
ZFIN ID:
ZDB-GENE-050522-279
Description:
Novel calpain family protein (Zgc:112467) [Source:UniProtKB/TrEMBL;Acc:A5WWC4]
Mouse Orthologue:
Capn8
Mouse Description:
calpain 8 Gene [Source:MGI Symbol;Acc:MGI:2181366]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa5973 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa29806 Missense, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29807
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078111 Essential Splice Site 300 701 8 21
ENSDART00000144585 Essential Splice Site 300 700 8 21
Genomic Location (Zv9):
Chromosome 22 (position 27221967)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26603596
KASP Assay ID:
2261-6949.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGGGAATAGAATCTTGAAAATACTATAAAAACAAAAATGTCTTTTTCA[G/T]TTCCAAAGAGTGGGACAGTGTCCGACCAGAAGAGAAAGCTAAACTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5973
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078111 Essential Splice Site 544 701 14 21
ENSDART00000144585 Essential Splice Site 544 700 14 21
Genomic Location (Zv9):
Chromosome 22 (position 27216016)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26609547
KASP Assay ID:
554-3701.1 (used for ordering genotyping assays)
KASP Sequence:
AGATATAGACCCACATTTCAAACGCCTCTTCAGTCARGTTGCTGGAAGCG[T/A]AAGTCACAACTGGTCAATATAAATTTGAATCATTATCATGATTTTTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29806
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078111 Missense 564 701 15 21
ENSDART00000144585 Nonsense 564 700 15 21
Genomic Location (Zv9):
Chromosome 22 (position 27215879)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26609684
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTCTCTGTATTGGAGCTCCAGCAGATCCTGAACACCGTTGTCTCGAAA[C/T]GTAAGAAAACACATTAACTTTTTTTTATTGACATATTTTAAATGTCTGAA
Associated Phenotype:
Not determined