Busch Lab

ZMP

FMNL1 (1 of 2)

Ensembl ID:
ENSDARG00000055713
Description:
formin-like 1 [Source:HGNC Symbol;Acc:1212]
Human Orthologue:
FMNL1
Human Description:
formin-like 1 [Source:HGNC Symbol;Acc:1212]
Mouse Orthologue:
Fmnl1
Mouse Description:
formin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1888994]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa6040 Nonsense Mutation detected in F1 DNA Not yet available
sa3326 Essential Splice Site Available for shipment Available now
sa18761 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10153 Essential Splice Site Available for shipment Available now
sa5729 Essential Splice Site F2 line generated Not yet available
sa33252 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6040
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Nonsense 261 1125 8 31
Genomic Location (Zv9):
Chromosome 3 (position 37209239)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37072599
GRCz11 3 37214457
KASP Assay ID:
554-3674.1 (used for ordering genotyping assays)
KASP Sequence:
CATCTTTTTTTCCCAAACAGTCTGGGTTTAATTTAGTCATGACACACCCT[A/T]GATGTGTCAACGAAATCACACTTAGTCTCAACAACAAAAACCCCAGGTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5217
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Nonsense 480 1125 14 31
Genomic Location (Zv9):
Chromosome 3 (position 37214200)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37077560
GRCz11 3 37219418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGACAGAGAGAAGGGGAGTGAAAAAGAGTCCAAACTGGAGAAAAAACTC[A/T]AAGAACTGCAGGAGAAAGGCTTACTTCGACTGGAGCGCACAGYCTCTGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2140
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Nonsense 626 1125 17 31
Genomic Location (Zv9):
Chromosome 3 (position 37215329)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37078689
GRCz11 3 37220547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGCYGCAGCACCACCTCCACCTCCTCCMCCCCCTCCACTACCTGGCGCT[G/T]AAGCWCCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3326
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 627 1125 17 31
Genomic Location (Zv9):
Chromosome 3 (position 37215334)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37078694
GRCz11 3 37220552
KASP Assay ID:
554-2620.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGCACCACCTCCACCTCCTCCMCCCCCTCCACTACCTGGCGCTKAAGC[A/T]CCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGTGCTCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa18761
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 632 1125 18 31
ENSDART00000083495 Essential Splice Site 632 1125 18 31
Genomic Location (Zv9):
Chromosome 3 (position 37215380)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37078740
GRCz11 3 37220598
KASP Assay ID:
2259-3851.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCACCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGT[G/A]CTCCTCCCCCTCCCCCTCCGCCACCTCCCCCTGGTGGAGGTCCACCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10153
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 632 1125 18 31
ENSDART00000083495 Essential Splice Site 632 1125 18 31
Genomic Location (Zv9):
Chromosome 3 (position 37215380)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37078740
GRCz11 3 37220598
KASP Assay ID:
2259-3851.1 (used for ordering genotyping assays)
KASP Sequence:
AAGCWCCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGT[G/A]CTCCTCCCCCTCCCCCTCCGCCMCCTCCCCCTGGTGGAGGTCCACCACCM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5729
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 654 1125 20 31
Genomic Location (Zv9):
Chromosome 3 (position 37215650)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37079010
GRCz11 3 37220868
KASP Assay ID:
554-3489.1 (used for ordering genotyping assays)
KASP Sequence:
ATGCTGAGCACTCTACACTGAGCCTGGTGACTGTATATCCATTTTTTCTG[G/C]TGTTTTACACAGGACCAAAGGCACGCAAAAYAATTCAGACAAAGTTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33252
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 992 1125 26 31
Genomic Location (Zv9):
Chromosome 3 (position 37224357)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37087717
GRCz11 3 37229575
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACAGTGATGTATTAGACTCCCTCGTTAAAGATGGCAAAACAGCACAGG[T/C]GAGACCCCAGGAACACACTCAGAAACACACACACTGTACTATAAATGAAT
Associated Phenotype:
Not determined