Busch Lab

ZMP

cpd

Ensembl ID:
ENSDARG00000055648
ZFIN ID:
ZDB-GENE-081112-2
Human Orthologue:
CPD
Human Description:
carboxypeptidase D [Source:HGNC Symbol;Acc:2301]
Mouse Orthologue:
Cpd
Mouse Description:
carboxypeptidase D Gene [Source:MGI Symbol;Acc:MGI:107265]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa32035 Nonsense Available for shipment Available now
sa13438 Essential Splice Site Available for shipment Available now
sa22648 Splice Site, Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2827
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 115 1350 1 21
ENSDART00000078035 Nonsense 115 1350 1 21
Genomic Location (Zv9):
Chromosome 15 (position 24110887)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24822074
GRCz11 15 24757339
KASP Assay ID:
2260-8509.1 (used for ordering genotyping assays)
KASP Sequence:
AACCCAAATTCAAGTATGTGGGCAACATGCACGGAGACGAGACCGTGTCC[C/T]GACAGGTGTTGGTTTACCTGCTGGAGGACCTACTGGAGAAGTACGGGGAG
Long Flanking Sequence:
TTGAAACTATTTTGGCTGTCATTGAAACTCCACCCTTTGTTAAAGCGTTAGCAGGAAGTTCTTACTAAAAATACCCCCGACGTCAGGCTAAAGAAAGAACCCGACCCAGCCGGACAGATTTTGGGATTTCATGAGGACGCCAAGGTGCCTTCGGAAACATGTCGGGACAGAGGGCAAGAGACCTGTGTTCAGCGAATAAATGCCCGCTGCTGCTTTTATCTCTGCTCGTTGTTTATATCAGCTCCATCAACTCAGTTTCCGCAGGCGAGCTGAAGACAGAGACTTACAACAAATACTACAATTACGACGAACTTACCGAGCTTCTCAAAAGTCTCGCCGTTAAACACCCCAGCATCGCCAATCTGACCAGCATCGGCAGGTCCGTTGAAGGCAGAGAGCTGTGGGTGATGAGAGTCACCAAAGACATCAGTGCTGCTGATGGAACAGGAAAACCCAAATTCAAGTATGTGGGCAACATGCACGGAGACGAGACCGTGTCC[C/T]GACAGGTGTTGGTTTACCTGCTGGAGGACCTACTGGAGAAGTACGGGGAGGATCAGCGGGTCACGGAGCTCGTCAACACCACCGATATTTACATCCTGCCGAGTATGAATCCTGACGGCTTTGAAAGGTCCGTGGAGGGGGATTGTTTGGGCAAAGATGAGGGTCGGCATAATGCTAAAAACATCGACCTGAATAGAAGTTTCCCAGATCAGTTTGAGGAAATACACTTGAATGCAGAAGACATCCCTGAAGTTACTGCTGTCATAAAGTGGATCCTGGAGAACAAGTAAGGCCATTCACGTAGACTTGCTAGAAAAATCAAACTTATGACCATATGAAAGGAATAGTTCAACCCTCACTCAAAAATGTTGCTTGTTAAAACTACTTATTTAAAATGAGTTGGAACAGCACAATTCTTGAGTTTTTTTGGGGGGACAACCTAATTTTTTATGTTAAACCCACCTAAATTTGTAAAAACTAATAAATTAACTTTAGTTCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19115
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 115 1350 1 21
ENSDART00000078035 Nonsense 115 1350 1 21
Genomic Location (Zv9):
Chromosome 15 (position 24110887)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24822074
GRCz11 15 24757339
KASP Assay ID:
2260-8509.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCCAAATTCAAGTATGTGGGCAACATGCACGGAGACGAGACCGTGTCC[C/T]GACAGGTGTTGGTTTACCTGCTGGAGGACCTACTGGAGAAGTACGGGGAG
Long Flanking Sequence:
TTGAAACTATTTTGGCTGTCATTGAAACTCCACCCTTTGTTAAAGCGTTAGCAGGAAGTTCTTACTAAAAATACCCCCGACGTCAGGCTAAAGAAAGAACCCGACCCAGCCGGACAGATTTTGGGATTTCATGAGGACGCCAAGGTGCCTTCGGAAACATGTCGGGACAGAGGGCAAGAGACCTGTGTTCAGCGAATAAATGCCCGCTGCTGCTTTTATCTCTGCTCGTTGTTTATATCAGCTCCATCAACTCAGTTTCCGCAGGCGAGCTGAAGACAGAGACTTACAACAAATACTACAATTACGACGAACTTACCGAGCTTCTCAAAAGTCTCGCCGTTAAACACCCCAGCATCGCCAATCTGACCAGCATCGGCAGGTCCGTTGAAGGCAGAGAGCTGTGGGTGATGAGAGTCACCAAAGACATCAGTGCTGCTGATGGAACAGGAAAACCCAAATTCAAGTATGTGGGCAACATGCACGGAGACGAGACCGTGTCC[C/T]GACAGGTGTTGGTTTACCTGCTGGAGGACCTACTGGAGAAGTACGGGGAGGATCAGCGGGTCACGGAGCTCGTCAACACCACCGATATTTACATCCTGCCGAGTATGAATCCTGACGGCTTTGAAAGGTCCGTGGAGGGGGATTGTTTGGGCAAAGATGAGGGTCGGCATAATGCTAAAAACATCGACCTGAATAGAAGTTTCCCAGATCAGTTTGAGGAAATACACTTGAATGCAGAAGACATCCCTGAAGTTACTGCTGTCATAAAGTGGATCCTGGAGAACAAGTAAGGCCATTCACGTAGACTTGCTAGAAAAATCAAACTTATGACCATATGAAAGGAATAGTTCAACCCTCACTCAAAAATGTTGCTTGTTAAAACTACTTATTTAAAATGAGTTGGAACAGCACAATTCTTGAGTTTTTTTGGGGGGACAACCTAATTTTTTATGTTAAACCCACCTAAATTTGTAAAAACTAATAAATTAACTTTAGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32035
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 756 1350 10 21
Genomic Location (Zv9):
Chromosome 15 (position 24127902)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24839089
GRCz11 15 24774354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATCCGCCAGTTGCGGATCTGCAGAAATACTGGGAACAAAACCGCAAAT[C/A]ACTTCTGCAGTTCATCCATCAGGTCTGACTCTTTTTAAAAAAAATTATAT
Long Flanking Sequence:
TAATGCGTGGATGAGAATGGCTGTGTTATTGTTGAATGTTGGTGTGCTGTCAGGTATTGTCACTTTGGAATTATAAGGTTCTATCTGCGTTCTGAATGATTTTGAGATATTGAGCTTTAAAGTTTTTGCATTCCATAGCAAACAGCACGTGTGTAACATTTGTTTTTTTTTTAAATAAAAAGTTTTAAAATATAAACATCCTATATTTTAAATAAGTTATCAATTAATAAGAATATGTCAATAACTCAATTTTGACAAAAACCTTATAATTAAGGTGACAAATTTTGTTCATTTTCATAAACATGAACATGTTCATGAAATTTTATTAAGGAAAGCAAGGTATAAAATTGTGTTATGAATGCATTATGTATTTCCCTCAGGAGGAATGCAGGACTGGAACTACATGAACACAAACTGCTTTGAGGTGACTATTGAACTGGGCTGTCACAAATATCCGCCAGTTGCGGATCTGCAGAAATACTGGGAACAAAACCGCAAAT[C/A]ACTTCTGCAGTTCATCCATCAGGTCTGACTCTTTTTAAAAAAAATTATATTTTCACTTTGCCTTTAAACTGCTTTTTTTCTCTCCGCCTATTTTCTGCTACACACCATATAAACTATTTGTTCGACCATCCAGGTCCACCGTGGAGTAAAAGGAATGGTAATCGACAGCAAAGATGGATCTGGCATTCCCAATGCTACCATCACTGTGGAAACCATCCATCATCAAGTCACATCCAGTTCTTTAGGGGACTACTGGCGCTTACTCGTTCCAGGAAAATACAAGCTGACTGCCTCTGCCCAAGGGTACAATTGTGAATTTTACGCGTGATTACTTTTGACCAAACTGATTTGCATATATTTTAAAGCTCACAGAGGCCATTAAATCCCTAAGTGGTCACTGTTTTAATAATACTAAACATTTAAAATAATTTAATTGTTTACTTAATGGCAGGAATAATGTTGTAACTTTAGATTATTGGAATTAATTCAATTTAGGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13438
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Essential Splice Site 1032 1350 15 21
Genomic Location (Zv9):
Chromosome 15 (position 24137148)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24848335
GRCz11 15 24783600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACTATTTTATGTGTGTCAATAACTTGTGATTCTTTATGTGTTTTTTTC[A/T]GTAGGTAATGCATCTCAGCGAGTTTCAGAACCTCAGCCAGAGACACGCGC
Long Flanking Sequence:
ATGCACATTTTTTCTTATAGAGTAAAAAGTTTATCCTACTCGGGTATGCGCATACATTTTTATGCGCATTTTCAAAATGTATGTGCATCTTGGCGTTTCCATCAACCATTTTTTCATATGCGCACATCCAAAATCCACATAAAAATAGGTGGATGGAAACATAGCTATTGTTATTAGTGATTACGATTTCTGACATGTTTGTTTGTACGTTACCATTAATCTCTCCCATAGGCTTACAAAAATCTTATAAAACCTTCACATGGTCTTTGTTCCCCATCTTTAGCTCATAAATGAGACAAGAATTGTTATCCTGCCAAGCATCAACCCAGATGGACGTGAGCTGGCGAAGGAAAGAGACTGCACCTCCACTGTTGGCATGACCAATGTGCATGGCAAAGACCTTGACACTGACTTCATTGGTGGGATCATGTTCAAATTATCCCTTATGCTTCACTATTTTATGTGTGTCAATAACTTGTGATTCTTTATGTGTTTTTTTC[A/T]GTAGGTAATGCATCTCAGCGAGTTTCAGAACCTCAGCCAGAGACACGCGCTGTGATGAATCTGATTCAGGAAAGAGGCTTCACTCTCTCTGTGGCTCTGGATGGAGGCTCATTGTTGGTCACTTATCCATATGACAAACCAGTGCAAACCGGTATGCAACTTAATGCCATTAATTTAGTAATAACTTAATGATTTTGATGAATCGGTTACTAATATGAATATATTAGTATAAAAATCATAAAGATAGATTTTGTCAAAATGCCTAATAAATTCAGTTCTCAAGTTTGTTATTTGCTTCTCAATTTCAGTTGAAAATGATGACACACTGAGATATCTGGCCACTGTGTATGCTGATCACCATCCCACAATGCACTTGGGTAACACTGGATGTCCAAACAGCGTCCAAAGTATGATGATTTCTTCCATTTATTGTTCTTATGTTTTGAAAACAGCCATCTGTCATTATTTCAGTAACAAAAAATGCTCAGCACATTGATTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28454
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 1073 1350 15 21
Genomic Location (Zv9):
Chromosome 15 (position 24137274)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24848461
GRCz11 15 24783726
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTTCACTCTCTCTGTGGCTCTGGATGGAGGCTCATTGTTGGTCACTTA[T/A]CCATATGACAAACCAGTGCAAACCGGTATGCAACTTAATGCCATTAATTT
Long Flanking Sequence:
TCCAAAATCCACATAAAAATAGGTGGATGGAAACATAGCTATTGTTATTAGTGATTACGATTTCTGACATGTTTGTTTGTACGTTACCATTAATCTCTCCCATAGGCTTACAAAAATCTTATAAAACCTTCACATGGTCTTTGTTCCCCATCTTTAGCTCATAAATGAGACAAGAATTGTTATCCTGCCAAGCATCAACCCAGATGGACGTGAGCTGGCGAAGGAAAGAGACTGCACCTCCACTGTTGGCATGACCAATGTGCATGGCAAAGACCTTGACACTGACTTCATTGGTGGGATCATGTTCAAATTATCCCTTATGCTTCACTATTTTATGTGTGTCAATAACTTGTGATTCTTTATGTGTTTTTTTCAGTAGGTAATGCATCTCAGCGAGTTTCAGAACCTCAGCCAGAGACACGCGCTGTGATGAATCTGATTCAGGAAAGAGGCTTCACTCTCTCTGTGGCTCTGGATGGAGGCTCATTGTTGGTCACTTA[T/A]CCATATGACAAACCAGTGCAAACCGGTATGCAACTTAATGCCATTAATTTAGTAATAACTTAATGATTTTGATGAATCGGTTACTAATATGAATATATTAGTATAAAAATCATAAAGATAGATTTTGTCAAAATGCCTAATAAATTCAGTTCTCAAGTTTGTTATTTGCTTCTCAATTTCAGTTGAAAATGATGACACACTGAGATATCTGGCCACTGTGTATGCTGATCACCATCCCACAATGCACTTGGGTAACACTGGATGTCCAAACAGCGTCCAAAGTATGATGATTTCTTCCATTTATTGTTCTTATGTTTTGAAAACAGCCATCTGTCATTATTTCAGTAACAAAAAATGCTCAGCACATTGATTGCAATCTTTTTAATGGCTTAAATTTATAGGTAGAGGATACATTTTTGCCATTTTTTTTAATATATATTTTCTTTCTGTGTTGCTGAGCAGGTAACATCCCTGGTGGCGTCCTTCGAGCAGCAGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22648
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Splice Site, Nonsense 1083 1350 16 21
Genomic Location (Zv9):
Chromosome 15 (position 24137459)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24848646
GRCz11 15 24783911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTAATAAATTCAGTTCTCAAGTTTGTTATTTGCTTCTCAATTTCAGTT[G/T]AAAATGATGACACACTGAGATATCTGGCCACTGTGTATGCTGATCACCAT
Long Flanking Sequence:
TGCCAAGCATCAACCCAGATGGACGTGAGCTGGCGAAGGAAAGAGACTGCACCTCCACTGTTGGCATGACCAATGTGCATGGCAAAGACCTTGACACTGACTTCATTGGTGGGATCATGTTCAAATTATCCCTTATGCTTCACTATTTTATGTGTGTCAATAACTTGTGATTCTTTATGTGTTTTTTTCAGTAGGTAATGCATCTCAGCGAGTTTCAGAACCTCAGCCAGAGACACGCGCTGTGATGAATCTGATTCAGGAAAGAGGCTTCACTCTCTCTGTGGCTCTGGATGGAGGCTCATTGTTGGTCACTTATCCATATGACAAACCAGTGCAAACCGGTATGCAACTTAATGCCATTAATTTAGTAATAACTTAATGATTTTGATGAATCGGTTACTAATATGAATATATTAGTATAAAAATCATAAAGATAGATTTTGTCAAAATGCCTAATAAATTCAGTTCTCAAGTTTGTTATTTGCTTCTCAATTTCAGTT[G/T]AAAATGATGACACACTGAGATATCTGGCCACTGTGTATGCTGATCACCATCCCACAATGCACTTGGGTAACACTGGATGTCCAAACAGCGTCCAAAGTATGATGATTTCTTCCATTTATTGTTCTTATGTTTTGAAAACAGCCATCTGTCATTATTTCAGTAACAAAAAATGCTCAGCACATTGATTGCAATCTTTTTAATGGCTTAAATTTATAGGTAGAGGATACATTTTTGCCATTTTTTTTAATATATATTTTCTTTCTGTGTTGCTGAGCAGGTAACATCCCTGGTGGCGTCCTTCGAGCAGCAGTGTGGCACAGTCACATGGGCAGCATGAAGGTAAATTACCAACTAAATATAGTAATTTTTTAAAGGCAAGGCACTGCAGGTGAATAAGGTGGAAATTTAACTATGTTAAAAGATGTAAATTAGACCATATTTATTAAAATAACGTCAAATTGTTTTATATGTATATTACAGTCAAAGTTGTTTACAGAAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2832
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 1208 1350 19 21
ENSDART00000078035 Nonsense 1208 1350 19 21
Genomic Location (Zv9):
Chromosome 15 (position 24141230)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24852417
GRCz11 15 24787682
KASP Assay ID:
2260-8513.1 (used for ordering genotyping assays)
KASP Sequence:
AGAACGGTAAGCCCATCGTGGGTGCTGCAATTGTGTTGAACGGTGGTGTT[C/T]GAGTCTACACTAGTGAAGGAGGGTATTTCCATGCTCTTCTGGCTCCTGGT
Long Flanking Sequence:
CAAAAGACTTGAATTACCAGCTGATGGACGAATGTTTAATTGATGGCTGTATTATTGCATAAGATGACATGAGGCAGCTATATCACTGTTTTGTCATTGCAGATATTTAAATAAATGTTTATTAAATAAAAGATAGCAAGTGACCTAATGAACTAAATGACAGTTATTTGTGAAATCGAAATTCCTCCTTTTCTACATGTTGCAGGACTTCAGTGTGGACTTTGGTCACTGTCCCGAGATCACAGTCTACACCAGCTGCTGTCTGTTTCCTTCAGCTGAAATGCTGCCCTCGCTCTGGGCTGAGAACAGGAAGTCTCTTCTGAGCATGCTGGTTGAGGTCAGTCTGTTGTTTTCTCTGTCACTCTGTTCATTTTTGTCCGTTTCATCTTGGCTTTAAGTTTGCTCTTCTGTTGTAGGTGCACAAAGGGGTTCGTGGAATAGTCAAGGATAAGAACGGTAAGCCCATCGTGGGTGCTGCAATTGTGTTGAACGGTGGTGTT[C/T]GAGTCTACACTAGTGAAGGAGGGTATTTCCATGCTCTTCTGGCTCCTGGTTTACACAGCATTGAAGCGGTGGCTGATGGATACCAACAGCAATCACAGAAGGTAAATATTTTTTGTTTATTTTATTTTATTTTATTTTATTATTATTTTTATGAATTTTTTATTATTATTTTATTTTATTTATTTATTTTTCTATTGTGTTATTTTTTATTTTATTTTATTTTTATTTTGTTTTTTATTTTATTTTTATTTTTTATTTATTTATTTTTTTGCTTATTTTGTTTTTATTTGTTTTATTTAATTTGTTTTATTTTATTTTGTTTTGTTTATTACTCTGTTTTTATTTGATTTATTTTTTGTTTTATTTTATTTTTGTTTTGTTTTGTTTAGTTTTTATTGTATTATTGTTTAGTTTTTACTTTATTTTAATGTATTTTGTTGTTTTTATTTTGTTTTAGTTATATATTTTTTCATTTTTGTTTTATTTCTATTTTGTTTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19116
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 1208 1350 19 21
ENSDART00000078035 Nonsense 1208 1350 19 21
Genomic Location (Zv9):
Chromosome 15 (position 24141230)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24852417
GRCz11 15 24787682
KASP Assay ID:
2260-8513.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACGGTAAGCCCATCGTGGGTGCTGCAATTGTGTTGAACGGTGGTGTT[C/T]GAGTCTACACTAGTGAAGGAGGGTATTTCCATGCTCTTCTGGCTCCTGGT
Long Flanking Sequence:
CAAAAGACTTGAATTACCAGCTGATGGACGAATGTTTAATTGATGGCTGTATTATTGCATAAGATGACATGAGGCAGCTATATCACTGTTTTGTCATTGCAGATATTTAAATAAATGTTTATTAAATAAAAGATAGCAAGTGACCTAATGAACTAAATGACAGTTATTTGTGAAATCGAAATTCCTCCTTTTCTACATGTTGCAGGACTTCAGTGTGGACTTTGGTCACTGTCCCGAGATCACAGTCTACACCAGCTGCTGTCTGTTTCCTTCAGCTGAAATGCTGCCCTCGCTCTGGGCTGAGAACAGGAAGTCTCTTCTGAGCATGCTGGTTGAGGTCAGTCTGTTGTTTTCTCTGTCACTCTGTTCATTTTTGTCCGTTTCATCTTGGCTTTAAGTTTGCTCTTCTGTTGTAGGTGCACAAAGGGGTTCGTGGAATAGTCAAGGATAAGAACGGTAAGCCCATCGTGGGTGCTGCAATTGTGTTGAACGGTGGTGTT[C/T]GAGTCTACACTAGTGAAGGAGGGTATTTCCATGCTCTTCTGGCTCCTGGTTTACACAGCATTGAAGCGGTGGCTGATGGATACCAACAGCAATCACAGAAGGTAAATATTTTTTGTTTATTTTATTTTATTTTATTTTATTATTATTTTTATGAATTTTTTATTATTATTTTATTTTATTTATTTATTTTTCTATTGTGTTATTTTTTATTTTATTTTATTTTTATTTTGTTTTTTATTTTATTTTTATTTTTTATTTATTTATTTTTTTGCTTATTTTGTTTTTATTTGTTTTATTTAATTTGTTTTATTTTATTTTGTTTTGTTTATTACTCTGTTTTTATTTGATTTATTTTTTGTTTTATTTTATTTTTGTTTTGTTTTGTTTAGTTTTTATTGTATTATTGTTTAGTTTTTACTTTATTTTAATGTATTTTGTTGTTTTTATTTTGTTTTAGTTATATATTTTTTCATTTTTGTTTTATTTCTATTTTGTTTATT
Associated Phenotype:
Not determined