Busch Lab

ZMP

ankrd33aa

Ensembl ID:
ENSDARG00000055638
ZFIN ID:
ZDB-GENE-080520-2
Human Orthologue:
ANKRD33
Human Description:
ankyrin repeat domain 33 [Source:HGNC Symbol;Acc:13788]
Mouse Orthologue:
Ankrd33
Mouse Description:
ankyrin repeat domain 33 Gene [Source:MGI Symbol;Acc:MGI:2443398]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12836 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4222
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078030 Essential Splice Site 137 452 3 4
ENSDART00000143662 Essential Splice Site 137 428 4 5
ENSDART00000078030 Essential Splice Site 137 452 3 4
ENSDART00000143662 Essential Splice Site 137 428 4 5
Genomic Location (Zv9):
Chromosome 23 (position 28109077)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27941899
GRCz11 23 27868440
KASP Assay ID:
554-6195.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGAAAACACGAAAGATTCTTAATACTTAATTCTAAGTTTAAATGTTGC[A/C]GGTTTCGTAACCATCCTCACTTACATCATCAATTTCTTCCCTGGACTTGA
Long Flanking Sequence:
ATTTTCAAAATAGGGTGTACTCAGTTATGCTGAACACTGTAAATCCAAACATGGCACAACATTAAAACCTAATTCATGCAACAGTCTGTTCTTCCTGTGAAAAAACACACCGCATAACACTTATTTTCAACATTTATACAATACAATCAAAATCTGAGTTCATATAACCTATTTCGATCAAAAACTTTTATTAATACTTGTGTGAAATCAACTTGGTTTTACAGTGTACCAGAAATTTTGCAAAAAAAAATTGTTGACTTCATTTTACCTGCTGACAAACTCTTATTCCCCAATAGAATGGTCTGATGCTGGCAGTCTCAAAAGGCTTTGTGGATATTGTGTATGGACTCAATCAGTGCCCATTTCTGGATATCAATCATCAGGATAATGATGGCAACACTGCACTTATGATCGCCGCACAAGCTGGTAGGTTCTTTATGAACACATAAAGCAGAAAACACGAAAGATTCTTAATACTTAATTCTAAGTTTAAATGTTGC[A/C]GGTTTCGTAACCATCCTCACTTACATCATCAATTTCTTCCCTGGACTTGACATGGAGCTCCGGGATAACAGAGGCTTCACGGCTCTCCTCAAGGCAGTCATGCAGGGCAGCAATGACTGTGTGGCGTCACTGCTCATGGCTGGTATGTTATTTTAGGACTCTTATAATTAGTTTATAGACTGGACAGGTCAAATAGGTGAGTTCCTACCGGCAGGGGCAAACAGAATGACGTGAATTGGGGAATAATGTTGAAAACCAATGGTATGCTGCTCCATTTTCCTTGCACATGTAGAGCAAAATCTGTAAAAACAAGTAAAGAGAATAAACAGAACACTTAGTGAACACTTTTGAACATTAATCAAGGTATTGCAGACAGTTTTATACTTGTACATGTTATTATTTAAATGTAAATGTACAGTACACTCTCAGAAAAAAGATACGAGAATGGTTTGTGGGGAATGGTGGCATCTCTAAGGTATGTTTTGTGTATATTTGGATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19328
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078030 Essential Splice Site 137 452 3 4
ENSDART00000143662 Essential Splice Site 137 428 4 5
ENSDART00000078030 Essential Splice Site 137 452 3 4
ENSDART00000143662 Essential Splice Site 137 428 4 5
Genomic Location (Zv9):
Chromosome 23 (position 28109077)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27941899
GRCz11 23 27868440
KASP Assay ID:
554-6195.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGAAAACACGAAAGATTCTTAATACTTAATTCTAAGTTTAAATGTTGC[A/C]GGTTTCGTAACCATCCTCACTTACATCATCAATTTCTTCCCTGGACTTGA
Long Flanking Sequence:
ATTTTCAAAATAGGGTGTACTCAGTTATGCTGAACACTGTAAATCCAAACATGGCACAACATTAAAACCTAATTCATGCAACAGTCTGTTCTTCCTGTGAAAAAACACACCGCATAACACTTATTTTCAACATTTATACAATACAATCAAAATCTGAGTTCATATAACCTATTTCGATCAAAAACTTTTATTAATACTTGTGTGAAATCAACTTGGTTTTACAGTGTACCAGAAATTTTGCAAAAAAAAATTGTTGACTTCATTTTACCTGCTGACAAACTCTTATTCCCCAATAGAATGGTCTGATGCTGGCAGTCTCAAAAGGCTTTGTGGATATTGTGTATGGACTCAATCAGTGCCCATTTCTGGATATCAATCATCAGGATAATGATGGCAACACTGCACTTATGATCGCCGCACAAGCTGGTAGGTTCTTTATGAACACATAAAGCAGAAAACACGAAAGATTCTTAATACTTAATTCTAAGTTTAAATGTTGC[A/C]GGTTTCGTAACCATCCTCACTTACATCATCAATTTCTTCCCTGGACTTGACATGGAGCTCCGGGATAACAGAGGCTTCACGGCTCTCCTCAAGGCAGTCATGCAGGGCAGCAATGACTGTGTGGCGTCACTGCTCATGGCTGGTATGTTATTTTAGGACTCTTATAATTAGTTTATAGACTGGACAGGTCAAATAGGTGAGTTCCTACCGGCAGGGGCAAACAGAATGACGTGAATTGGGGAATAATGTTGAAAACCAATGGTATGCTGCTCCATTTTCCTTGCACATGTAGAGCAAAATCTGTAAAAACAAGTAAAGAGAATAAACAGAACACTTAGTGAACACTTTTGAACATTAATCAAGGTATTGCAGACAGTTTTATACTTGTACATGTTATTATTTAAATGTAAATGTACAGTACACTCTCAGAAAAAAGATACGAGAATGGTTTGTGGGGAATGGTGGCATCTCTAAGGTATGTTTTGTGTATATTTGGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12836
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078030 Nonsense 441 452 4 4
ENSDART00000143662 None None 428 None 5
Genomic Location (Zv9):
Chromosome 23 (position 28103408)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27936230
GRCz11 23 27862771
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGGCCAAAGAGGAGAAAAAAAAAGAGAAGAAAAAAGAAGAACAGGAG[A/T]AGCTGGAAAAAGGAGCCAAGAAAAAAAGTAAAAAGTGATTCAACTGCCAA
Long Flanking Sequence:
GTATCATGGACCATATGGTGCGTATGACCACAAGCATCCATAGTCCCCTGGTGGTCACAGGATGCCGTCCGCTGTGTCCCTCAAGCCCACCAGAGGTGGGCAAGAGACGCCTAGCGGTGCCTGAACTGATGGAAATGCATTCAGGGAAAAAGCTTGAGGAGCACACAATACGACACAGCAATGGCTCCATCTCTGTGGCGTCTACATCTGGCTCTTCTGTCTCGCTGGCCTCATGCTGTTCTGAATCAGAACGGAGAGGCAGTGTGCTTTCCATGGCCTCCAACGGCGTTCGCAGGTTCGTCCCGCGCAGCATGGCCCGCCGCAACAGTGTGTTTCCGGCTGGCTGTGTTCCTCAAATCAAAGTGACTAAGTCTGGAGAGCCAACACCCAAGAAGGAGAAGAAGAGCAAGCGAAACAAAGGTTACTTAGAGCCACCGATCTGGAAGTACAAGGAGGCCAAAGAGGAGAAAAAAAAAGAGAAGAAAAAAGAAGAACAGGAG[A/T]AGCTGGAAAAAGGAGCCAAGAAAAAAAGTAAAAAGTGATTCAACTGCCAACAGAATGCACTCCGATTTATCTAAAGACATTTGATTTATATTTGTAACCTCAATATGATTAATACCTCTCCGGGAACCAGTAGGCCTGTATTTACAGACATTTTTAACATGTTAACATTTTATTTGAGATGATTTTTAAAATCTCTTTAAAAATGTTTGTTCACCCAAAAAAAAAAATGTTGTTAATTATTAATTATCAATGTATCATTCCAAACATTAACACAAATTAAGATATTTTACATGAAATCTGAGAGCTCTCTCTCGCTCCATAGACAGCAGGGTTTCCAATTCACTTAAAAACATCCTCAAAACAGACCATATGACTTCACTGGTTCAATGGGAATATTATCAAAGCTATGATAATACTTTTGTGCATACATAAAACAAAAATAACAGCCTTAATCAACAGACTCCTCTTTTCGGTCTCAGTTTATTGCACGCGATCATGAG
Associated Phenotype:
Not determined